SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16602
Annotation
PREDICTED:_small_G_protein_signaling_modulator_3_homolog_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 2.653
 

Sequence

CDS
ATGGATCTTGCCAAATCGTTATTCAGTTCAAGAGATCATGTTGGGTATGTCGGTCGTGAAGACCACGAACGTAAGATTAGTGCAGCGCTGAACGATGATGACCCTGAAGACGTGATCGACGCGATTAGAGGACTAAACATAGCTGATGAACTTCTTCCTGCGCCAGGAGGGCCATTTTCTGCTCTAACGCCTAGTATGGTACCTCAAGACATAATGGCTAAACTAGCACAACCAGAATCCGAAGGACACGGGGGTGGACTACCAGACTACAGTTTCGACGAGTTTGGCTTTTGTATTGAAGAAGAAGATGGTCCGGAACAAAGCTCAAACAAATTATTAGCTAATGCATTTGTTGAAGATGATCAACATAGACTGCAATGGGAGTTTTACAGCAAAGAAATTAACTTTACCGAAGGCAGTGGTAAGCTTGAAAAATCAGATAAACTACAGAAAATGGTCAAAGATGGTGTACCACATTCACTTAGGCCTCAAGTCTGGATGCATTTATGTGGAGCTAACAAGAAACGAGCATCAACTGAAATAACATATCATGAAATTGTAAGGGCATCAAGTGATGATGGTTTGGTAACTAGCAAACAAATAGAAAAAGATTTAGTCCAAATTCTGCCTAATAATGTTTGTTTCTCACATCCAACTAGCACTGGTGTACCTCGGCTTAGACGCATCCTCAGAGCCTTAGCATGGCTCTATCCAGACATTGGATACTGTCAAGGGACAGGAATGATTGCAGCATCACTATTACTATTAATGGAAGAAGAAGAAGCATTCTGGATAATGTGTACAACAGTGGAAGATCTTTTACCAGCTTCTTATTATTCATCAACACTGATTGGAATCCAAGCAGATCAAAAAGTTTTAAGGAGTCTTATATCAAACTATTTACCAGGCATCGACCAGGTCCTTAATGCTCACGACATTGAACTATCACTTATCACAATGCATTGGTTTCTAACTTTGTATGCTAATGTAGTCCATATGAAAATTTTATTAAGAATATGGGATCTATTTTTCTTTGATGGCTCTATTGTCTTGTTTAAAGTAACATTAGCGATGTTGAAAATAAAAGAAAATAGATTCACAGAAATCTCCAACTCCGCCCAAATCTTCAATGCTCTCTCTGATATACCTGGGGAAATTGATGATGTTGAACTTCTAATAAAAACCATTGATGAGGTATGTGGTGATACTCTAAGTCCTGCATTAATAGAAACACACAGAAGAAGACACTTGGCATACTTAATGGCAGATCAAGGTGCTCTTGTTGGAAATCCAAATGTTGTACCAAACTTGCCTAAGCAGCAATTGCAGAGGCGTCAAATAAAAAAGAGCAAGTCTGTAATACAAACTATTTTGTTTGGGGAAGATGGTAGTAATGAAGATGCTATTTCTAAGAATGTGAAGCAAACTGAAATACTAGTGGACTTGAGAGAAGCAATACTACAGGTTGCAAGGCACTTCCTAGCTTTAGAACCACAACTGACTTCAGAAGTTCAAATGACAGCTGATTACACCATGCAGAGTCATGCTGCTGATAGGGAAAGATACGTTAATGTTTCCAGAAGCAAGAGGCGAAGGGCAAAAGCTCTATTAGACTTTGAGAGAAGAGATGGTGATGAATTAGGATTCAGAAAAAATGATGTTATTGAAGTTATAAGTTCAAGAGATGAACACTGTTGGATTGGAGAACTAAACGGGTTGAGGGGCTGGTTTCCTGCTAGATTTGTCAAATTGCTCGATGAAAAGGGTGTAAAATATAGCAAGGCTGGTGATGATTCTGTCACGGAAAAAGCTGCACACTTAGTGAGAGGTGTATTAGCTCCAGCATTTAAAAGAGTTCTCTTGCATGGTATAAAGAGGCCAAGCTTTCTAGATGGACCATGTCATCCGTGGCTATTCATTGAAGAAGCCTCTTCTCGCGAAGTTGAAAAAGATTTTAATTCAGTTTACAGCCGCTTGGTTCTCTGTAAGACATATAGATTAGATGAAGATGGGAAGGTGTTGACTCCTGAAGAGTTATTATACAGATGTGTCCAAGCAATAAATTTATCACATGACAATGCTCATGCTCAGATGGATGTGAAATTGCGCACATTAATATGTATGGGCTTAAATGAAGAAGCATTACATCTGTGGCTTGAAGTATTGTGTTCTTGTGTTGATGTCGTTCAAAAATGGTATCATCCATGGTCATTTATAAATTCGCCTGGATGGGTACAGATCAAATGTGAATTACGTATACTTTCTCAGTTTGGTTTCAATTTGAACCCCGATTGGGAGCTTCCATTGAAAAAAGATACACAAAATCAGCCACTGAAGGAAGGTGTAAGAGATATGCTTGTTAAACACCATTTATTCTCATGGGACTTGTGA
Protein
MDLAKSLFSSRDHVGYVGREDHERKISAALNDDDPEDVIDAIRGLNIADELLPAPGGPFSALTPSMVPQDIMAKLAQPESEGHGGGLPDYSFDEFGFCIEEEDGPEQSSNKLLANAFVEDDQHRLQWEFYSKEINFTEGSGKLEKSDKLQKMVKDGVPHSLRPQVWMHLCGANKKRASTEITYHEIVRASSDDGLVTSKQIEKDLVQILPNNVCFSHPTSTGVPRLRRILRALAWLYPDIGYCQGTGMIAASLLLLMEEEEAFWIMCTTVEDLLPASYYSSTLIGIQADQKVLRSLISNYLPGIDQVLNAHDIELSLITMHWFLTLYANVVHMKILLRIWDLFFFDGSIVLFKVTLAMLKIKENRFTEISNSAQIFNALSDIPGEIDDVELLIKTIDEVCGDTLSPALIETHRRRHLAYLMADQGALVGNPNVVPNLPKQQLQRRQIKKSKSVIQTILFGEDGSNEDAISKNVKQTEILVDLREAILQVARHFLALEPQLTSEVQMTADYTMQSHAADRERYVNVSRSKRRRAKALLDFERRDGDELGFRKNDVIEVISSRDEHCWIGELNGLRGWFPARFVKLLDEKGVKYSKAGDDSVTEKAAHLVRGVLAPAFKRVLLHGIKRPSFLDGPCHPWLFIEEASSREVEKDFNSVYSRLVLCKTYRLDEDGKVLTPEELLYRCVQAINLSHDNAHAQMDVKLRTLICMGLNEEALHLWLEVLCSCVDVVQKWYHPWSFINSPGWVQIKCELRILSQFGFNLNPDWELPLKKDTQNQPLKEGVRDMLVKHHLFSWDL

Summary

EMBL
ODYU01005012    SOQ45482.1    NWSH01000012    PCG80885.1    GDQN01001443    JAT89611.1    + More
AGBW02011690    OWR46296.1    JTDY01011872    KOB52372.1    KQ460106    KPJ17780.1    KQ459602    KPI93571.1    KQ978273    KYM95786.1    KQ980765    KYN13418.1    GL888273    EGI63560.1    GEZM01098364    GEZM01098363    JAV53911.1    KQ981744    KYN36236.1    KZ288212    PBC32810.1    ADTU01021606    KQ435732    KOX77328.1    KQ982691    KYQ52266.1    AJWK01022430    GL450241    EFN81303.1    KQ971307    EFA11199.1    KQ414855    KOC60115.1    KQ434816    KZC06860.1    GFDF01003511    JAV10573.1    NNAY01002052    OXU22236.1    CH477270    EAT45318.1    JRES01000776    KNC28427.1    JXUM01141446    KQ569247    KXJ68704.1    KK852605    KDR20408.1    KA648161    AFP62790.1    NEVH01024424    PNF17267.1    AAAB01008987    EAA00950.3    GFTR01008066    JAW08360.1    GL442888    EFN62823.1    ADMH02001839    ETN60964.1    GBGD01000508    JAC88381.1    KQ976641    KYM78759.1    GBYB01008217    JAG77984.1    AXCM01001384    AXCN02000272    DS232083    EDS34333.1    LBMM01003103    KMQ93968.1    CCAG010018530    APGK01047197    APGK01047198    KB741077    ENN74217.1    JXJN01008224    APCN01002011    CH933806    EDW15678.1    CH902629    EDV35324.1    CH954181    EDV48966.1    CM000364    EDX12869.1    CM000160    EDW97499.1    CH480815    EDW42100.1    AE014297    AY058625    AAF55144.1    AAL13854.1    CH479185    EDW38096.1    CM000070    CH673789    EAL28876.1    EDY71553.1    DS234988    EEB09854.1    CH916369    EDV92581.1    CH940650    EDW66892.1    OUUW01000008    SPP83690.1    GAMC01006423    JAC00133.1    ATLV01020011    KE525292    KFB44767.1    GDHF01025508    JAI26806.1    GAKP01017631    JAC41321.1    KRT01146.1    KRT05560.1    GDHF01001491    JAI50823.1    CH964232    EDW81078.1    GBXI01007221    JAD07071.1    CP012526    ALC47742.1    QCYY01001796    ROT75270.1    GEBQ01028534    JAT11443.1    GGLE01002742    MBY06868.1    NEDP02005310    OWF42207.1    HACG01030830    CEK77695.1    JH431971    JH818393    EKC32427.1    HACG01030828    CEK77693.1    GACK01005196    JAA59838.1    ABJB010212080    ABJB010437114    ABJB010923066    DS612847    EEC00207.1   
Pfam
PF00018   SH3_1        + More
PF02759   RUN
PF00566   RabGAP-TBC
PF00575   S1
PF03876   SHS2_Rpb7-N
Interpro
IPR037213   Run_dom_sf        + More
IPR035969   Rab-GTPase_TBC_sf       
IPR036028   SH3-like_dom_sf       
IPR004012   Run_dom       
IPR001452   SH3_domain       
IPR000195   Rab-GTPase-TBC_dom       
IPR035833   SGSM3_SH3       
IPR036898   RNA_pol_Rpb7-like_N_sf       
IPR005576   Rpb7-like_N       
IPR012340   NA-bd_OB-fold       
IPR003029   S1_domain       
IPR018247   EF_Hand_1_Ca_BS       
SUPFAM
SSF50044   SSF50044        + More
SSF140741   SSF140741       
SSF47923   SSF47923       
SSF50249   SSF50249       
SSF88798   SSF88798       
Gene 3D
PDB
4P17     E-value=3.30556e-27,     Score=306

Ontologies

Topology

Length:
796
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
4.54366999999999
Exp number, first 60 AAs:
0.00011
Total prob of N-in:
0.01428
outside
1  -  796
 
 

Population Genetic Test Statistics

Pi
5.972249
Theta
12.056915
Tajima's D
-1.420845
CLR
17.691098
CSRT
0.0705964701764912
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号