SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16592  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004547
Annotation
PREDICTED:_twitchin_[Amyelois_transitella]
Full name
Twitchin       + More
Titin      
Titin homolog      
Myosin light chain kinase, smooth muscle      
Immunoglobulin-like and fibronectin type III domain-containing protein 1      
Myomesin-1      
Myosin-binding protein C, fast-type      
Myosin-binding protein C, slow-type      
Myosin-binding protein C, cardiac-type      
Myomesin-2      
M-protein, striated muscle      
Striated muscle preferentially expressed protein kinase      
Myomesin-3      
Obscurin      
Alternative Name
Uncoordinated protein 22
Connectin
Rhabdomyosarcoma antigen MU-RMS-40.14
Telokin
Kinase-related protein
D-Titin
Kettin
EEF1A2-binding protein 1
KY-interacting protein 1
190 kDa connectin-associated protein
190 kDa titin-associated protein
Myomesin family member 1
C-protein, skeletal muscle fast isoform
C-protein, skeletal muscle slow isoform
C-protein, cardiac muscle isoform
165 kDa connectin-associated protein
165 kDa titin-associated protein
M-protein
Myomesin family member 2
Myomesin family member 3
Muscle M-line assembly protein Unc-89
Skelemin
Location in the cell
Cytoplasmic   Reliability : 2.023 Nuclear   Reliability : 1.464
 

Sequence

CDS
ATGCTCTCAGATATCGGACCTGGACACGGAGACCGGGCGCTGGATGCCGGCCGCCAAGACCAAGGACCCCAAGGCCGAGCTGGAGAACCTCGTCCCGGACACGAGTACAAGTTCAGAGTGTCCGCCGTCAACAACGAGGGGCAGTCCGAGCCGCTGGAGGCAGAACATTCGATCATCGCTAAAAATCCGTTTGACGAGCCCGGCAAGCCCGGCACACCTGAGGTGGTGGACTGGGACAAGGACCACGTGGACCTCAAATGGGAGAAGCCGGTCAAGGACGGCGGAGCTCCCATCACCGGGTACATCATCGAGAAACGCGAAGTCGGCTCGCCTAAGTGGGTGAAGGCTTGCGAGGTCGGACCTAACGACAACGACAAGGCCACAGTGCCGAACCTGGACGAAGGTACGGAGTACGAGTTCCGTGTCCGTGCGGTCAACGAGGCCGGCCCGGCGAGCCAGCGACGCCAGCAAGAGCGTCGTCTGCAAGCCCAGGAGACTGCCCCCAAAGATCGATCGTCGCAACCTTCGTACCATCAAGGTCCGCGAGGGCGAGCCCATCGCGCTGGACGTGAAGGTCTCCGGCGAGCCCGCCCCGAGGTCACGTGGACCCTCAACGGAAAGTCCGTCCTCAGTGGAAACGGACTCAAACTGGTGAACGTGCCGTACATAAGCAAGTATCAGCACGCGAGTCCGCGCCGCAAGGACTCCGGCACGTACAAGATACAGGCCACCAACAAGTACGGGCAGGACACCGCCGAGCTCGAGATCATTGTCACATCGAAACCCGACAAGCCGGAGGGGCCGCTCGAAGTGTCGGACGTGCACAAGGACGGCTGCACGCTCAAGTGGAAGCGGCCCAAGGACGACGGAGGCGAGCCCATCGACTCCTACCTCGTCGAGAAGTACGACACCGAGACCGGCGTGTGGCTGCCCGTGGGCAACACCATCGGCAACGTGCCCGAGATGGAAGTCGAGGGTCTAACGCCGGGCCACGAGTACAAGTTCCGCGTGAAGGCGATCAATAAGGAGGGTGAATCGGAGCCTCTAGATACGTACGGAGCTATTGTCGCTAAGGATCCCTACACCGTACCAGACGCGCCTTCAGCTCCCGTCCCAGACGACTGGTCGGCCAACCACGTGGACCTCAAATGGGAGGCGCCGCTATCAGACGGAGGATCGCCCATTATCGGCTACATCGTCGAGAAGAAAGACAAATACAGTCCGCTGTGGGAGAAGGCTGTGGAGACCCACACGCCCACACCCACTGCTACTGTAAATGGGCTGATCGAAGGCAACGAGTACCAGTTCCGTGTGATCGCTATCAACAAGGCTGGTCAGAGCAAACCCTCGGACTCTTCTAAGAACTTCGTGGCGAAGGCTCGCTTCCTGGCTCCGAAGATCGACAGGAGACACCTCCGTGACGTCACTCTGTCCGCCGGAGCTACACTCAAGCTGGAGGCCGCCGTCGCAGGAGAACCAGCTCCAGCTGTTGAATGGAGATACCAAAATATGCCTCTGCGGCCATCGAAGGCGGTGAGCATCGACAACCCGGAGTACTTCACGAAGCTGGTGGTGCGGCCGGTGCGGCGCGACGACACCGGCGAGTACACCGTCACCGCGGTCAACTCCAGCGGGAAAGACGCCGTCACCATCAACGTCACCGTCACCGACAAGCCCACCAAGCCCGAGGGACCGATACAGATCTCGGATGTCCACAAAGAGGGAGCTACACTCAAATGGAAGAGGCCCAAGGACGACGGCGGCACTCCCATCGAGTACTACCAGATCGACAAGCTCGACACCGACACCGGCTGCTGGGTGCCCTGTGCTAGATCTGAGGAGCCTAAATGCGACGTCACCGGTTTGACTCCTGGCAAGGAGTACAAGTTCCGCGTGTCTGCCGTCAATGCTGAGGGCGAATCTGAACCGCTGGTGACAGACCACGCCATCGTCGCTAAGAATCCGTTCGACGAACCTGGCGCACCCGGAACGCCAACCGTTACCGACTGGGACAAGGACCACGTGGACCTCAAATGGACCCCACCACGCGAAGACGGCGGCGCTCCTGTCGAAGCTTACATCGTCGAGAAGAAGGACAAGTTCGGCAACTGGGAGAAGGCCGTCGAGGTACCGGCCAGCAAGACCTCCGCCACCGTGCCCGATCTTATCGAAGGACAGACCTACGAGTTTAGAGTACGTGCGGTGAACAAGGCCGGGCCAGGCGAGCCCAGCGATAGCACTCATCCTATCGTCGCCAAGCCCAGGAACATGGCGCCCAAGATCGACAGGACCAACCTTATCGATATTAAGATCAAAGTCGGACAGAAATTCGGATTTGATGTTAAGGTATCCGGAGAACCGATGCCTGTAACGAAATGGTACCTGGCGAAGAAGGAAGTGAAGTCCGGCGGCGACATGAAGGTGCAGCACACGGACTACAACACGAAGCTGAGCTGCAAGGCGGCCACGCGCGCCGACAGCGGCCGCTACACCGTCACCGCGGAGAACAGCAACGGGAAGGACGTGGCCGAGGTCGAGGTCGTCGTGCTCAGCGTGCCCGCGCCACCCGGTGGACCGCTTAAGGTATCGGACGTACACGCGAACGGCGCCACGTTGTCGTGGAGGCCGCCGCCCGACGACGGCGGACAGCCCATCGACAAGTACGTGGTGGAGCGCATGGACGAGGCCACGGGGCGCTGGGTCACGGCCGGCGAGACCGACGGGCCCGTCACCAGCCTCGCCGTCGACGGCCTGCAGCCCGGACACAAGTACAAGTTCCGGGTCAGCGCTGTTAACAGACAAGGCCGTTCCGACCCCCTTACGACTCCGCACTCCACGGAAGCCAAGAATCCGTTCGACGTGGCTGGCAAACCTGGCACACCGAAGATCAAGGACTTCGACAAAGACTTTGTGGAACTGGAATGGACCAGACCGCAAACCGATGGAGGGGCTCCCATCACCGGATACGTCATTGAGAAGAAGGATCGATTCGCGCCCGACTGGGAAGAATGCGCAAAGATCGACGGTGACGTTACATCTGGTAAAGTCCCGGACCTCATTGAAGGCAATACATATGAATTCCGTGTTCGTGCCGTCAACAAGGCCGGCAAGGGTGAGCCTAGTGACGGCACCGCTCCACACCTGGCCCGTCCCAAGAACCTGCCGCCCAAGATCGACAGGAACTTCATGTTCGACATCAAAGTTAAGGTCGGACAGAACTTCGACCTCGAGGTGCCGGTCGCCGGCGAACCCACTCCGACCAAGGAGTGGCTCCACGGTGACAACGTTGTCCTCAACACCGACAGAATCAAAATCGTCAATGATGACCACAGCACGAAGTTCCGCGTCATCGATGCCAAGCGAGCGGACACCGGCACGTACACGCTCAAAGCGAGAAACATCAACGGTACCGACACCGCTACCGTCAAGGTGCTGGTCATGGACGTGCCCACCGCTCCCGAGGGACCGCTGCGTGCCGACGACATCACTAAATCTGGATGCACGCTGCGCTGGAGACCACCCAAGGACGACGGTGGTGCCGAAATCACCCACTACGTCGTCGAGAAAATGGACCAGGAGAACTTGCGCTGGATCCCTGCCGGCGAGGTACAGGGCTGCAACATCAGGATAGATCATCTCATCGAAGGACACGACTACAACTTCAGAGTCCGCGCCGTCAACAAACATGGCGAGTCACAACCTCTTGTTGGGCACGAGCCCATCACTGCCAAGGATCCTTATGGTACCCCCGACAAGCCCGGAACACCTGTCGTCAAAGACTGGGACAAAGATCACATGGACCTGGAATGGGTGCCACCAAAGAAGGACGGAGGTTCACCCATTACTGGCTACATTATAGAAGCGAAGAAGAAGTATGGACCTTGGGAAGTGGCGGCCACCGTGCCAGGAAATCAAACCACCGCTACAGTACCTGGCTTACAAGAAGGCGAGGAATACGAGTTCAGAGTAATCGCTGTTAACAAGGCCGGCAATGGAGAACCTAGCGATGGGTCCACTCCACAAGTCGCTAAGGCCAGGTTCTGTGCCCCACACTTCGATAAGATGCTACTCGCAGATAAGACAGTTAAGGCGGGACAGAGGATTCAATACGAGATCCCTATCGAAGCCTCGCCTAAACCTACTGTCGAGTGGCAGATCAACGGCAAAGTCGTCCATCCTTCGGACAGGGTCGACATACAACTGCTGCACAACAGGGTCATACTGGACATTCCATTCTCCGTCCGCAGCGACGGAGGCGTTTATAAACTGACCCTCAAAAACGACCTCGGAGTCTGCTCGGCGACTGCTCAAGTCACAGTGCTGGACAAACCCTCGAGACCGGAGAAGCCGTTGACCGTTTCCGATATCACGAAAGACTCTTGCTCGTTATCATGGAGAGTGCCTCTGGACGACGGAGGCTCGCCGATCTTACATTACGTCATAGAAAAGATGGATCTGACCCGCGGCACTTGGTCGGACGCTGGAATGAGCACATTCCTGTCGCACCAGGTCACTAGATTAATTCACAAGAAAGAGTATTTGTTCAGAGTGAGCGCCGTGAATGCCATCGGACAATCTGAACCTCTTGAACTGGAGCGAGCTATCGTCGCCAAGAACGAATTCGACGAGCCCACCGCGCCTGGCAAACCTGAAGCCACAGACTGGAGCAAGAATCACGTCGACCTACAATGGGCTGCGCCTAAATCGGACGGAGGATCACCGATTACGGGCTACATCATTCAAAAGAAAGAAAAAGGAAGCCCATACTGGGTGAACGCTGTGCATGTACCACCCAGCAAGACCAAAGCAACCGTGCCCGACTTAACCGAGGGTCAAGATTACGAGTTCAGAGTGATCGCCGTCAATCAAGCCGGTCAGTCCGAGCCTAGCGAGCCCTCTGACGTCATCACCGCCAAGGACAGGTTCGTCGCACCCAAGATCCTTACTCCACTCAAGGAGATCCGTATCAAAGCCGGTCTTATCTTCCACTTCGACGTGGACTTTATCGGGGAACCGACTCCCGAGGTCACATGGACGTGTGACGGTAAACCTGTTGTAACTAACGAAAGAACGACGGTTACGTCTGTCGGCCATCACACCATTATCCACACGGTTAACTGCAAACGCTCCGAGGCTGGTACATACCATCTGAAATTGAAGAACGATTCCGGCACCGATGAAGGCTCCTTCGAATTGATAGTGCTCGATGTGCCGGGAGCTCCCCAGCCTCCGTTCACTTACGAAGAAATCACAGCACAATCGGTTACTTTGTCATGGAAACCTCCCAAAGATAATGGCGGCAGTGAACTCACAGCCTACGTCATTGAGAAACGAGACCTCAGTCACGGCGGCGGCTGGGTGCCCGCGGTAACGTACGTCAACCCGAAGTACAATCACGCTACTGTCCCCAGGCTCTCGGAGGGCACACAGTACGAGTTCAGAGTATTCGCTGAGAACTTGCAAGGACGCTCCGAACCTTTGGTTACAGATAAGCCTATTGTCGCCAAAAACCAGTACACGGTGCCTGGCAAACCCGGGAAACCGGAGCTCGTCTCTGCAGACAAAGACCACATCAAGGTCCGATGGTCTTCGCCTATTTCGAACGGTGGATCTAACATTCTCGGCTATGACGTTGAAAGGAGAGACAAGGCCACTGGCCGCTGGATCAAACTGAACAAGGAACCCGTGAGGTTCAATGAATACCAAGACGATAGAGTGCAAGAAGGTCACCAGTATGAGTACAGAGTGTCCGCCGTTAATGCAGCAGGACCTGGACAACCTTCTGACGAATCTAACGTGTTCATCGCGAAGCCCATGAAGGAGAAACCCAAACTCTGGCTTGATCACCTGATCGGCAAGAAGATCAAGGTTCGCGCCGGTGAACCAATCAACATTAACATTCCAATCACCGGCGCTCCCACGCCGACCATCTCGTGGACTAAGGGCTCCGTTCCTCTTGTGCCATCGCACAGATTATCAGCTGAAACCAAGAACGATGAGACTAAACTGTCTATCGAGAAATCAACAAGAGAAGACGCCGGAAAATACACAATTTCCGCGTCTAACGCACACGGCAATGATTCAGCGGACATCGAAGTCATCGTCGTAGATAAACCGGGAGTACCGAAAGGTCCTCTCATGTGCAACCCCGTTACGCACGACGCCATCAGCCTCACGTGGCAGCCTCCCACCGACGACGGCGGCAGCGAGATCACCGGCTACGTCGTTGAAGTCGCCGAATTTGGCGTCAACGATTGGCGCACCGTGGCCGGATTCTGCCCTAAATGTTCGTTCACTGTGAAGAACTTAACCGAAGGCAAGAAGTACGTATTCAGAGTGCGCGCCGAGAATCTATACGGCCTCTCTGATCCCCTGGAGAGCAAACCGATCATTGCCAAGTCGCCGTTCGATCCGCCTGACGCGCCAGACACGCCGAAGGTCACCGGGTACAGCTCGAACAGCTGCTCACTGGAATGGCACCCGCCCGCGAACTGTGGAGGCAAGCCTGTCACCGGATACTATGTCGAGAAGAGGGAACGCGGTGGGGACTGGGTAAAGGTCAACAACTACCCCACTCCCAATACGTGCTATACCGTTTCGGACTTGCGCGAAGGAAACAAGTATGAGTTCCGTGTGATCGCCGTCAACGAGGCTGGACCCGGGAAACCGAGCAAGCCTACCGAGCCGATCACTGCTCAAACACAGCGACTCAAGCCTAGCGCTCCTGAAGCGCCGAAACCGGACAGAATCACTAAAGATTCCGTCACTTTATCCTGGAGACCACCTAAAAGCGACGGTGGAGCTAAGATTAAGGGCTACATCGTACAGCAAAAGGGCAAGGGCGACAAAGACTGGAAGGACGTCAATGACGTACCTATTCCGAGCCTCGTACATACTGTACCGAAACTCAAGGAAGGAGAAGAATACCAGTTCAGGGTTATCGCCGTTAACGAAGTCGGTAAATCGGAGCCAAGTAAACCTACCGCTGACATTACCATCGCGGAACAACCAAACAAGCCTTGCATGGACCTGGGTGGCGTCAGAGACATCACGGTGCGCGCCGGAGAAGACTTCTCCATTCACGTGCCGTACACTGGGTTCCCGCAGCCGACCGCGCAATGGTTTGCTGACGACAACCTGCTTGATGTCGAAGGCGACTCGAGAATTTTCCAAAAGATTACGCCCGACTCGGCGTCTTTGGTTGTCAAGAACGCTAAGAGATCCGACGGAGGACAATACCGCCTGCAGCTGCGTAATCCCTCTGGATATGACACAGCCACGATCAACGTCAGAGTGCTGGATCGACCCGGAAAACCGGAGAACTTGCGCGCTGACGAATTTGAAGGCGAAGCTCTCACGCTGTACTGGAACCCACCGAAAGAGAATGGCGGCGGTGAAATTACCAACTACGTCGTCGAGAAACGCGAGGCGCGCACGCCGAACTGGACCAAGGTGTCCGGCTACGTCACGACTCCGTTCCTGCGCGTCAAAAACCTGACTGTCGGGAAGAGCTACGAGTTCAGAGTTATGGCCGAAAACCAGTACGGACAGTCGGACCCGGCGCAAACAACTGAACCGATCAGGGCCAGACATCCATTCGACCCGCCAGGCCCGCCCGGCGTGCCGAAGTCGGTTGAAACCAGCGAAACTTCTATCACCATTACTTGGACCAAACCACGCCACGACGGTGGCTCTCCTATCACTGGTTACATAGTAGAGAAGCGACTCATCACGGAGGATAAGTGGACCAAGGCATGCCACGCGCACGTGCCCGACACGACCTTGAAGGTTACCGGTTTGATCGAGAACCACGAGTACGAGTTCCGTGTGTCCGCTGTGAACGCGGCGGGCCAGGGTCCCTGGTCACAGAGCTCGGACGCCATCCGCGCTCGGGCGCCGCCCAACTCGCCGCGCATCACCAGCGACCTCAGCCTCAGGGACATCACTGTCATCGCCGGGGAGGAGATCAAGATCACCGTGCCCTTCACTGGCAACCCAAGACCTAAGGTGTCATGGATAGTGAACAACGACGAAGTATTCCCGGACAACCGTATCCGCTTCGTGACGACGGACATCGACACAGTGTTCTACAACTCGTGCGCCAAGCGTACCGACACCGGCTCCTACACCATTCAACTGGTCAACAGTGAGGGCTCGGACAGCGCCACTTGCAGGGTACTCGTAGTTGACAAACCGACCCCGCCAGTGGGACCGCTGGACGCTTACGACATTACGCCCGACACGTGCACGTTGTCATGGAAACCGCCACTAGACGACGGCGGCTCTCCCATCACCAACTACGTCGTCGAGAAGATGGACAATAACGGAATCTGGACAAAGATATCATCGTTCGTTCGCAACTGTCATTACAACGTCATGGGCCTGGAACCGAACAGGAAATACTTGTTCAGGGTACGCGCCGAAAATCAATATGGCGTATCGGAACCTTTGACAATGGACGACTCTATTACGGCCAAGTTCCCGTTCACGATCCCCGAGCCGCCGGGAGCGCCGCGCGTCACGGACTGGGACGGCTCCACGGCGACCGTGCTGTGGGACCGGCCGCGCTCGGACGGCGGCTCCCGCATCCAGGGCTACAAGATCGAGTACAGGGACGTGCAGGACGGCGTCTGGAACAGCGCTGACTATCTCGTCAAGGATTGTAATTACCAGGCGTACAACTTGGAGCCGGGCCACGAGTACGAGTTCCGCGTGCGCGCCAAGAACGCGGCCGGCTTCAGCAAGTACTCGGGCTCGTCGCAGCGGTTCCGCGTGCGGGCGCGCTGCGGGCCCCCCGCGCCCCCCACCGCGCCGCGCGTGCTGCGCGTCGGCAGGAACTACGTCGACCTCAGCTGGGACCCGCCCAAGCACGACGGAGGTTCTCGCGTGACCGGCTACGTGATCGAGCGGCGCGACGTGGGCAGCTCGGTGTGGGTCAAGTGCAACGACTACAACGTGCAGGACACGACCTTCACCGCGCTCAACCTCAACGAGAAGGCGGACTACGAGTTCCGCATCATCGCCGTCAACGCGGCGGGTAAATCCGAGCCTTCTTCGTGCACGACCCCCGTACGTACCGGCGAAGAGATCGGAGGAACGAAGCCGGAATGGGTGAAGCAGCTGCCGGCCATCATGAGCGCCCCGCTCGGCCGCCCCTACACCCTGGAGTGCGTGGCGAGCGGGAACCCCGTTCCCACGGGTAGATGGCTCAAGAACGGCAGAGAAATCGTTCTTGGTACCAGGTTCATATCAGAGTCTCGTGAGGGTACACTGAAGCTCAACATCCTGGAGGCCGCGGACGCCGACGAGGGTGACTACACTTGTGAGGCGGTTAATAACATTGGCTTCATCTACTGTACTGGTCACCTTAAGATTGGAAGTCCACCACGCATCACCCGAATGCCTGGCGACCTTCACCTCCCTGAACACGACAACACCAAGATCAAGATCCTGTACACGGGAGACCAGCCCGCTGACGTCACGCTGTCCCGGGACGGACACAATCTCAAGGAGTCGCCGCATCTCAAGTTCACCGTATTCGATGATTACATACTTATATTCATCAAGGACATCACTAAAGACGATATGGGCATATACAAAGTATCGATAAAGAACAACTCTGGCGAGACGTCGGACACGTTCTCCGTGACGGTGACGGGGCTGCCCGGCCCGCCACAGGGACCCCTCGAAGCGTCCGACATCTCCAAGCACTCCTGCACGCTGGCCTGGAAGCCTCCCGCGTACGACGGAGGGATGCCCGTCACTCACTACGTCATCGAGCGTAACGACACCTCGGGAACGGCCTGGATCACCATCGCCTCGTCCGTCCGGGACACCAAGTTCATTGTCCAGGGACTCACCGAAGGACACGAGTACAACTTTAGAATTCACGCTGCGAACGAGAACGGTATCGGACCAGCTCTGGAAGGTCTCAATCCGATTAAGGCTAAAGCACCATACGATCCGCCATCTGCTCCTGGTATTCCCAAGATCCTGGAGGTCGGAGGCGACTTCGTCCACTTGGAATGGGACAAACCAGAAAATGATGGAGGTGCTAGGATTCTAGGCTACTGGGTCGACAAGCGCGAAGTGGGCACATCGACGTGGCAGCGCGTGAACCCGACGCTGTGCCTGCCGAACCAGATCAACTGCTCCAACCTCATCGAGGGCCGCCAGTACGAGTTCCGCGTCGTCGCGCAGAACGAGGCCGGCGCGTCGCCGCCCAGCACCGCCAGCCAACAGGTCAAGGTCGTCGATCCCAAAGCCGCCACGCCACCAGAGATAGTGAAGCCACTGAAGAACGCCAACTGCATCCAGTACCACAACGCCAAGTTCCAGTGCACCATCACCGGGTCGCCCAGACCCACCATCACTTGGTACAAGGGTGCTCGTGAGATAACCAACGGACCGCGGTACCGCATCTGGAGCGAGGGCGACAACCACTACTTGACCGTCAACGACGTGTTCGGCGAGGACGCTGACGAATACGTCTGCAGGGCCGTCAACAAGGCAGGAGTCAAGAGCACCAGGGCTGAACTGCTTATTATGACCGCCCCGAAACTGAACGTGCCACCTCGGTTCCGCGTCACCGCCTACTTCGACAAGGGCGAGAACGTGGTCGTCAAGATCCCCTTCACCGGACACCCCATACCCAAGATCACTTGGGTTCGAGAGGGAGAGACCATCGAGTCTGGACTTCACTATCACGTGGAGAGGAAAGAACGTCACGCCATCCTGACCATCCGCGACGCGAGCAAGATCGACTCTGGTCCCTACAGGATCACGGCAGAGAACGAGCTGGGGCAGGACACGGCCATCATCAACATCGAGATCAGCGATCGGCCGGACCCACCGCGCTTCCCAGCGGTGGACAGCATCGGCGTGGACTCGCTGGCGCTGAGCTGGCGCGCCCCGGTGTGGGACGGCGGCTCCGACATCACCAACTACCTGGTCGAGAAGCGAGAGCACCCCATGACCAGCTGGATCAGGGTCGGGAATACCAGGTTCACGACAATGGCTATAACCGGTCTGGTGCCGGGCAAGCAGTACGAGTTCAGGGTGTACGCTGAGAACATATACGGCCGGTCGGACCCCAGCGAGCCGACCTCGCTCGTGCAGACCAAGGCGATCGTTAAAAAGGAACTCAAGAAGAAGGAATACCCGGTGGACGAATCAGGCAAACGCATCCGCACGAACGCAGACCACGGCCCCGTCAAGGACTACGACAGCTACGTGTTCGACATCTACAGCAAGTACGTGCCGCAGCCCGTGGACATCAACACGTGCTCGGTTTACGACAAATACGACATACTAGAAGAGATTGGCACAGGCGCGTTCGGCGTGGTGCACCGCTGCCGCGAGCGCGCCACCGGCAACATCTTCGCAGCCAAGTTCATCCCGGTCGCCGGGGCCATGGAGAAGGAGCTCATCAAGAAGGAAATCGACATCATGAACCAGCTGCACCACAGGAAGCTGATCAACTTGCACGACGCCTTCGAGGACGATGACGAGATGGTGCTCATATTCGAGTTCCTGTCCGGCGGCGAGCTGTTCGAGCGCATAACGGAGCCCGGCTACAACATGAGCGAGGCGGAGGCCGCGCACTACATGAGGCAGATCTGCGAGGGCGTGAGACACATGCACGAGCAGAACATCATACACCTTGACCTCAAGCCCGAGAACGTCATGTGCCAGACCAGAACCGGAACCGACGTTAAGATCATCGATTTCGGATTAGCGACGAAGCTGGACCCGAACGAAGTGGTGAAGATCTCGACTGGAACCGCAGAGTTCGCCGCTCCGGAGATCGTAGAGAGGGAACCGGTCGGCTTCTACACGGACATGTGGGCCGTGGGAGTACTGGCCTATGTGCTATTATCCGGACTGTCGCCATTCGCCGGCAACAACGACATTGACACGCTCAAGAATGTTAAGGCCTGCGACTGGGAGTTCGACGAGGAAGCCTTCCAGCACGTCTCCGACGACGCCAAGGACTTCATCAGGAGGCTGCTCATTAAGAACAAGGAAAAACGAATGACCGCCCACGAGTGCCTGGTTCACAAGTGGCTGGCCGGCGACGCGGCCTCAAGTCGCACCGCCACCATCGAGGCGAGGAGATACGAAGCCATGAGGAACAGGCTCCGGGAGAGATACGAGAACTGGTCGTCATTCAAGTTGCCGATCGGCAGACTCAGCGAGTACAGCTCGCTCAGGAAACTCCTCATCGAGAAATGGAAGATATACGACGGACAGTTCGACCGTCGGCAGGCGGCGCCGCGCTTCGTGATCAAGCCGCAGTCTGCGTTCTGCTACGAGGGCCAGTCCGTGAAGCTGTACTGCCGCATCATCGCGTGCGCCACGCCCACCGTCACCTGGTCCCGGAACAACCACGAGCTGCGCCAGTCCGTCAAGTTCATGAAGAGATACGCCGGCGACGATTATTACTTCATCATAAACCGCGCCAAGCTGGAGGATCGCGGCGAGTACATCATCAGGGCGGAGAACCACTACGGCTTCAGGGAGGAAGTGGTATTCCTGAACGTGCAACCTGTGCCCAAAGTCCAGCGCACGCACGTGTCGGAGGCCCCGCGGCGCCGCGAGCCGCTGCCCTACACGTTCTGGCAGGAGACCAGCGAGACGGCGCCCGCCTTCACCTTCCAGCTGCGGCCGCGCGTCATGCAGGCGCGCGACACCTGCAAGCTGCTGTGCTGCCTCAGCGGCAAGCCCACGCCCACCGTCAAGTGGTACAAGGACAAACGCGAGCTGTCGAAGTACGACTACGCGATGGCGCACTCGGACGGCGTCGTGACCATGGAGATCATAGACTGTCGGCCCGAGGACAGCGGCAAGTACACGTGCGTCGCCACCAACGTGCACGGCACCGACGAGACCTCGTGCGTCGTTATCGTTGAAGGCGAGGTGACGTCACCAGAGCAACAGCGGATGGTGCACAACTTCTTACACTCGGGCGACCGGAGGTACATCGAGAAGCCGCTGAAGCCCGCCCCGCCGCCCATCATCACCAAGACGAAGGTGACGATAGACCCTCCATCAAAGACGGGTCCTCGTCCGAAGTACTCCCCCCAGAGCTCCGTGGACGCGAAGAAGAAGTACGGATCCAGACTCGACTCGGACGCGTCGTCGCGGTCCAGAAGCGCCACCAAGGAATTGATAATGCCGGCGGCGGACTCGTCGATGTGCGCGCCGACGTTCGCCCGCAGCCTGCCCGCCACGCTGTGCGCGCGCGACGCGGCGCCGCTGCTGCTGTCGTGCGCCGTGCGCGGCGACCCCGAGCCCTCCGTGCGCTGGTACAAGGACGCGAGCCCGCTGCACTCCTCAGAGGTCGTGGACTTGAAATACAAGAACGGTGTAGCGTCGCTGGCCATTAACGAGGTGTTCCCTGAGGATGAAGGAGTGTACTCCCTGAAGGCTACCAACAGCCAGGGAGAGGTGGAGACCAAATGTATAGTTACAGTTAAACCAATGGACACGAGCGCCGGCAGCGCGGCACTGAAGGCCGGAGACAAGCCCCCGAGGATAGTCGACCACGCCGTCTCGCAGGTCGTCAACGACGGCGACCCGGTCACGCTGTCCTGCAGGATCGTGGGAGCCGAACGCTTCGATGTAGTCTGGCTGCACAACAACAAGGAGATCAAACCGTCCAAAGACTTCCAGTACTCGAGCGAGGCGAACATACACAAGCTGCACATCGCCGAAATATTCCCAGAGGATGCCGGTACATACACGTGCGAGGCGTTCAACGACGCCGGCGAGTCGTTCTCGTCGTGCTCGGTGGTGGTGCGCGTGCCGGGCGAGGCGCCCCCCGCCCCGCACTACGTGGCCTTCCCCGCCTCGCTCACCGTCAACGCGACCGAGCCCGCCGTCTTCACCGCAGAGCTGGACAAGCCACCGCTCCAGCTCCAGTGGCTGAAGGACGGCAAGCCGGTGGACGAGAGCTCGCCCGGTACCGGTTCAGCATGGAGGGCGAGGCGCGGTACCGCCTCGAGCTGGTGGGCGCCGCCCAGGGGGACGCCGGCCAGTACCAGGCCCGGGCCGTCGGCTCCAAGGGAGACGCGCTCGCATCCTTCTATCTCAACGTCACCGACCACTAGCCCATGA
Protein
MLSDIGPGHGDRALDAGRQDQGPQGRAGEPRPGHEYKFRVSAVNNEGQSEPLEAEHSIIAKNPFDEPGKPGTPEVVDWDKDHVDLKWEKPVKDGGAPITGYIIEKREVGSPKWVKACEVGPNDNDKATVPNLDEGTEYEFRVRAVNEAGPASQRRQQERRLQAQETAPKDRSSQPSYHQGPRGRAHRAGREGLRRARPEVTWTLNGKSVLSGNGLKLVNVPYISKYQHASPRRKDSGTYKIQATNKYGQDTAELEIIVTSKPDKPEGPLEVSDVHKDGCTLKWKRPKDDGGEPIDSYLVEKYDTETGVWLPVGNTIGNVPEMEVEGLTPGHEYKFRVKAINKEGESEPLDTYGAIVAKDPYTVPDAPSAPVPDDWSANHVDLKWEAPLSDGGSPIIGYIVEKKDKYSPLWEKAVETHTPTPTATVNGLIEGNEYQFRVIAINKAGQSKPSDSSKNFVAKARFLAPKIDRRHLRDVTLSAGATLKLEAAVAGEPAPAVEWRYQNMPLRPSKAVSIDNPEYFTKLVVRPVRRDDTGEYTVTAVNSSGKDAVTINVTVTDKPTKPEGPIQISDVHKEGATLKWKRPKDDGGTPIEYYQIDKLDTDTGCWVPCARSEEPKCDVTGLTPGKEYKFRVSAVNAEGESEPLVTDHAIVAKNPFDEPGAPGTPTVTDWDKDHVDLKWTPPREDGGAPVEAYIVEKKDKFGNWEKAVEVPASKTSATVPDLIEGQTYEFRVRAVNKAGPGEPSDSTHPIVAKPRNMAPKIDRTNLIDIKIKVGQKFGFDVKVSGEPMPVTKWYLAKKEVKSGGDMKVQHTDYNTKLSCKAATRADSGRYTVTAENSNGKDVAEVEVVVLSVPAPPGGPLKVSDVHANGATLSWRPPPDDGGQPIDKYVVERMDEATGRWVTAGETDGPVTSLAVDGLQPGHKYKFRVSAVNRQGRSDPLTTPHSTEAKNPFDVAGKPGTPKIKDFDKDFVELEWTRPQTDGGAPITGYVIEKKDRFAPDWEECAKIDGDVTSGKVPDLIEGNTYEFRVRAVNKAGKGEPSDGTAPHLARPKNLPPKIDRNFMFDIKVKVGQNFDLEVPVAGEPTPTKEWLHGDNVVLNTDRIKIVNDDHSTKFRVIDAKRADTGTYTLKARNINGTDTATVKVLVMDVPTAPEGPLRADDITKSGCTLRWRPPKDDGGAEITHYVVEKMDQENLRWIPAGEVQGCNIRIDHLIEGHDYNFRVRAVNKHGESQPLVGHEPITAKDPYGTPDKPGTPVVKDWDKDHMDLEWVPPKKDGGSPITGYIIEAKKKYGPWEVAATVPGNQTTATVPGLQEGEEYEFRVIAVNKAGNGEPSDGSTPQVAKARFCAPHFDKMLLADKTVKAGQRIQYEIPIEASPKPTVEWQINGKVVHPSDRVDIQLLHNRVILDIPFSVRSDGGVYKLTLKNDLGVCSATAQVTVLDKPSRPEKPLTVSDITKDSCSLSWRVPLDDGGSPILHYVIEKMDLTRGTWSDAGMSTFLSHQVTRLIHKKEYLFRVSAVNAIGQSEPLELERAIVAKNEFDEPTAPGKPEATDWSKNHVDLQWAAPKSDGGSPITGYIIQKKEKGSPYWVNAVHVPPSKTKATVPDLTEGQDYEFRVIAVNQAGQSEPSEPSDVITAKDRFVAPKILTPLKEIRIKAGLIFHFDVDFIGEPTPEVTWTCDGKPVVTNERTTVTSVGHHTIIHTVNCKRSEAGTYHLKLKNDSGTDEGSFELIVLDVPGAPQPPFTYEEITAQSVTLSWKPPKDNGGSELTAYVIEKRDLSHGGGWVPAVTYVNPKYNHATVPRLSEGTQYEFRVFAENLQGRSEPLVTDKPIVAKNQYTVPGKPGKPELVSADKDHIKVRWSSPISNGGSNILGYDVERRDKATGRWIKLNKEPVRFNEYQDDRVQEGHQYEYRVSAVNAAGPGQPSDESNVFIAKPMKEKPKLWLDHLIGKKIKVRAGEPININIPITGAPTPTISWTKGSVPLVPSHRLSAETKNDETKLSIEKSTREDAGKYTISASNAHGNDSADIEVIVVDKPGVPKGPLMCNPVTHDAISLTWQPPTDDGGSEITGYVVEVAEFGVNDWRTVAGFCPKCSFTVKNLTEGKKYVFRVRAENLYGLSDPLESKPIIAKSPFDPPDAPDTPKVTGYSSNSCSLEWHPPANCGGKPVTGYYVEKRERGGDWVKVNNYPTPNTCYTVSDLREGNKYEFRVIAVNEAGPGKPSKPTEPITAQTQRLKPSAPEAPKPDRITKDSVTLSWRPPKSDGGAKIKGYIVQQKGKGDKDWKDVNDVPIPSLVHTVPKLKEGEEYQFRVIAVNEVGKSEPSKPTADITIAEQPNKPCMDLGGVRDITVRAGEDFSIHVPYTGFPQPTAQWFADDNLLDVEGDSRIFQKITPDSASLVVKNAKRSDGGQYRLQLRNPSGYDTATINVRVLDRPGKPENLRADEFEGEALTLYWNPPKENGGGEITNYVVEKREARTPNWTKVSGYVTTPFLRVKNLTVGKSYEFRVMAENQYGQSDPAQTTEPIRARHPFDPPGPPGVPKSVETSETSITITWTKPRHDGGSPITGYIVEKRLITEDKWTKACHAHVPDTTLKVTGLIENHEYEFRVSAVNAAGQGPWSQSSDAIRARAPPNSPRITSDLSLRDITVIAGEEIKITVPFTGNPRPKVSWIVNNDEVFPDNRIRFVTTDIDTVFYNSCAKRTDTGSYTIQLVNSEGSDSATCRVLVVDKPTPPVGPLDAYDITPDTCTLSWKPPLDDGGSPITNYVVEKMDNNGIWTKISSFVRNCHYNVMGLEPNRKYLFRVRAENQYGVSEPLTMDDSITAKFPFTIPEPPGAPRVTDWDGSTATVLWDRPRSDGGSRIQGYKIEYRDVQDGVWNSADYLVKDCNYQAYNLEPGHEYEFRVRAKNAAGFSKYSGSSQRFRVRARCGPPAPPTAPRVLRVGRNYVDLSWDPPKHDGGSRVTGYVIERRDVGSSVWVKCNDYNVQDTTFTALNLNEKADYEFRIIAVNAAGKSEPSSCTTPVRTGEEIGGTKPEWVKQLPAIMSAPLGRPYTLECVASGNPVPTGRWLKNGREIVLGTRFISESREGTLKLNILEAADADEGDYTCEAVNNIGFIYCTGHLKIGSPPRITRMPGDLHLPEHDNTKIKILYTGDQPADVTLSRDGHNLKESPHLKFTVFDDYILIFIKDITKDDMGIYKVSIKNNSGETSDTFSVTVTGLPGPPQGPLEASDISKHSCTLAWKPPAYDGGMPVTHYVIERNDTSGTAWITIASSVRDTKFIVQGLTEGHEYNFRIHAANENGIGPALEGLNPIKAKAPYDPPSAPGIPKILEVGGDFVHLEWDKPENDGGARILGYWVDKREVGTSTWQRVNPTLCLPNQINCSNLIEGRQYEFRVVAQNEAGASPPSTASQQVKVVDPKAATPPEIVKPLKNANCIQYHNAKFQCTITGSPRPTITWYKGAREITNGPRYRIWSEGDNHYLTVNDVFGEDADEYVCRAVNKAGVKSTRAELLIMTAPKLNVPPRFRVTAYFDKGENVVVKIPFTGHPIPKITWVREGETIESGLHYHVERKERHAILTIRDASKIDSGPYRITAENELGQDTAIINIEISDRPDPPRFPAVDSIGVDSLALSWRAPVWDGGSDITNYLVEKREHPMTSWIRVGNTRFTTMAITGLVPGKQYEFRVYAENIYGRSDPSEPTSLVQTKAIVKKELKKKEYPVDESGKRIRTNADHGPVKDYDSYVFDIYSKYVPQPVDINTCSVYDKYDILEEIGTGAFGVVHRCRERATGNIFAAKFIPVAGAMEKELIKKEIDIMNQLHHRKLINLHDAFEDDDEMVLIFEFLSGGELFERITEPGYNMSEAEAAHYMRQICEGVRHMHEQNIIHLDLKPENVMCQTRTGTDVKIIDFGLATKLDPNEVVKISTGTAEFAAPEIVEREPVGFYTDMWAVGVLAYVLLSGLSPFAGNNDIDTLKNVKACDWEFDEEAFQHVSDDAKDFIRRLLIKNKEKRMTAHECLVHKWLAGDAASSRTATIEARRYEAMRNRLRERYENWSSFKLPIGRLSEYSSLRKLLIEKWKIYDGQFDRRQAAPRFVIKPQSAFCYEGQSVKLYCRIIACATPTVTWSRNNHELRQSVKFMKRYAGDDYYFIINRAKLEDRGEYIIRAENHYGFREEVVFLNVQPVPKVQRTHVSEAPRRREPLPYTFWQETSETAPAFTFQLRPRVMQARDTCKLLCCLSGKPTPTVKWYKDKRELSKYDYAMAHSDGVVTMEIIDCRPEDSGKYTCVATNVHGTDETSCVVIVEGEVTSPEQQRMVHNFLHSGDRRYIEKPLKPAPPPIITKTKVTIDPPSKTGPRPKYSPQSSVDAKKKYGSRLDSDASSRSRSATKELIMPAADSSMCAPTFARSLPATLCARDAAPLLLSCAVRGDPEPSVRWYKDASPLHSSEVVDLKYKNGVASLAINEVFPEDEGVYSLKATNSQGEVETKCIVTVKPMDTSAGSAALKAGDKPPRIVDHAVSQVVNDGDPVTLSCRIVGAERFDVVWLHNNKEIKPSKDFQYSSEANIHKLHIAEIFPEDAGTYTCEAFNDAGESFSSCSVVVRVPGEAPPAPHYVAFPASLTVNATEPAVFTAELDKPPLQLQWLKDGKPVDESSPGTGSAWRARRGTASSWWAPPRGTPASTRPGPSAPRETRSHPSISTSPTTSP

Summary

Description
Regulator of muscle contraction and relaxation. Senses mechanical strain that occurs during muscle activity by unfolding in clearly resolvable steps at differing forces (PubMed:18390597, PubMed:7190524). Plays a role in the organization of sarcomeres in body wall muscles (PubMed:25851606).
Key component in the assembly and functioning of vertebrate striated muscles. By providing connections at the level of individual microfilaments, it contributes to the fine balance of forces between the two halves of the sarcomere. The size and extensibility of the cross-links are the main determinants of sarcomere extensibility properties of muscle. In non-muscle cells, seems to play a role in chromosome condensation and chromosome segregation during mitosis. Might link the lamina network to chromatin or nuclear actin, or both during interphase.
Serine/threonine-protein kinase (PubMed:18390597, PubMed:20346955). Key component in the assembly and functioning of muscles. By providing connections at the level of individual microfilaments, it contributes to the fine balance of forces between the two halves of the sarcomere. The size and extensibility of the cross-links are the main determinants of sarcomere extensibility properties of muscle. In non-muscle cells, seems to play a role in chromosome condensation and chromosome segregation during mitosis. Might link the lamina network to chromatin or nuclear actin, or both during interphase (By similarity).
Calcium/calmodulin-dependent myosin light chain kinase implicated in smooth muscle contraction via phosphorylation of myosin light chains (MLC). Also regulates actin-myosin interaction through a non-kinase activity. Phosphorylates PTK2B/PYK2 and myosin light-chains. Involved in the inflammatory response (e.g. apoptosis, vascular permeability, leukocyte diapedesis), cell motility and morphology, airway hyperreactivity and other activities relevant to asthma. Required for tonic airway smooth muscle contraction that is necessary for physiological and asthmatic airway resistance. Necessary for gastrointestinal motility. Implicated in the regulation of endothelial as well as vascular permeability, probably via the regulation of cytoskeletal rearrangements. In the nervous system it has been shown to control the growth initiation of astrocytic processes in culture and to participate in transmitter release at synapses formed between cultured sympathetic ganglion cells. Critical participant in signaling sequences that result in fibroblast apoptosis. Plays a role in the regulation of epithelial cell survival. Required for epithelial wound healing, especially during actomyosin ring contraction during purse-string wound closure. Mediates RhoA-dependent membrane blebbing. Triggers TRPC5 channel activity in a calcium-dependent signaling, by inducing its subcellular localization at the plasma membrane. Promotes cell migration (including tumor cells) and tumor metastasis. PTK2B/PYK2 activation by phosphorylation mediates ITGB2 activation and is thus essential to trigger neutrophil transmigration during acute lung injury (ALI). May regulate optic nerve head astrocyte migration. Probably involved in mitotic cytoskeletal regulation. Regulates tight junction probably by modulating ZO-1 exchange in the perijunctional actomyosin ring. Mediates burn-induced microvascular barrier injury; triggers endothelial contraction in the development of microvascular hyperpermeability by phosphorylating MLC. Essential for intestinal barrier dysfunction. Mediates Giardia spp.-mediated reduced epithelial barrier function during giardiasis intestinal infection via reorganization of cytoskeletal F-actin and tight junctional ZO-1. Necessary for hypotonicity-induced Ca(2+) entry and subsequent activation of volume-sensitive organic osmolyte/anion channels (VSOAC) in cervical cancer cells (By similarity).
Calcium/calmodulin-dependent myosin light chain kinase implicated in smooth muscle contraction via phosphorylation of myosin light chains (MLC). Also regulates actin-myosin interaction through a non-kinase activity. Phosphorylates PTK2B/PYK2 and myosin light-chains. Involved in the inflammatory response (e.g. apoptosis, vascular permeability, leukocyte diapedesis), cell motility and morphology, airway hyperreactivity and other activities relevant to asthma. Required for tonic airway smooth muscle contraction that is necessary for physiological and asthmatic airway resistance. Necessary for gastrointestinal motility. Implicated in the regulation of endothelial as well as vascular permeability, probably via the regulation of cytoskeletal rearrangements. In the nervous system it has been shown to control the growth initiation of astrocytic processes in culture and to participate in transmitter release at synapses formed between cultured sympathetic ganglion cells. Critical participant in signaling sequences that result in fibroblast apoptosis. Plays a role in the regulation of epithelial cell survival. Required for epithelial wound healing, especially during actomyosin ring contraction during purse-string wound closure. Mediates RhoA-dependent membrane blebbing. Triggers TRPC5 channel activity in a calcium-dependent signaling, by inducing its subcellular localization at the plasma membrane. Promotes cell migration (including tumor cells) and tumor metastasis. PTK2B/PYK2 activation by phosphorylation mediates ITGB2 activation and is thus essential to trigger neutrophil transmigration during acute lung injury (ALI). May regulate optic nerve head astrocyte migration. Probably involved in mitotic cytoskeletal regulation. Regulates tight junction probably by modulating ZO-1 exchange in the perijunctional actomyosin ring. Mediates burn-induced microvascular barrier injury; triggers endothelial contraction in the development of microvascular hyperpermeability by phosphorylating MLC. Essential for intestinal barrier dysfunction. Mediates Giardia spp.-mediated reduced epithelial barrier function during giardiasis intestinal infection via reorganization of cytoskeletal F-actin and tight junctional ZO-1. Necessary for hypotonicity-induced Ca(2+) entry and subsequent activation of volume-sensitive organic osmolyte/anion channels (VSOAC) in cervical cancer cells. Responsible for high proliferative ability of breast cancer cells through anti-apoptosis.
Key component in the assembly and functioning of adult and embryonic striated muscles and muscle tendons. By providing connections at the level of individual microfilaments, it contributes to the fine balance of forces between the two halves of the sarcomere. The size and extensibility of the cross-links are the main determinants of sarcomere extensibility properties of muscle. In non-muscle cells, seems to play a role in chromosome condensation and chromosome segregation during mitosis. Might link the lamina network to chromatin or nuclear actin, or both during interphase.
Thick filament-associated protein located in the crossbridge region of vertebrate striated muscle a bands. In vitro it binds MHC, F-actin and native thin filaments, and modifies the activity of actin-activated myosin ATPase. It may modulate muscle contraction or may play a more structural role (By similarity).
May link the intermediate filament cytoskeleton to the M-disk of the myofibrils in striated muscle.
Structural component of the muscle M line which is involved in assembly and organization of sarcomere (PubMed:22467859, PubMed:26251439). Required for the development and organization of indirect flight muscle sarcomeres by regulating the formation of M line and H zone and the correct assembly of thick and thin filaments in the sarcomere (PubMed:22467859, PubMed:26251439). Likely to have serine/threonine-protein kinase activity as one of the two protein kinase domains appears to be functional (Probable).
Catalytic Activity
ATP + L-seryl-[protein] = ADP + H(+) + O-phospho-L-seryl-[protein]
ATP + L-threonyl-[protein] = ADP + H(+) + O-phospho-L-threonyl-[protein]
[myosin light chain]-L-serine + ATP = [myosin light chain]-O-phospho-L-serine + ADP + H(+)
[myosin light chain]-L-threonine + ATP = [myosin light chain]-O-phospho-L-threonine + ADP + H(+)
Cofactor
Mg(2+)
Ca(2+)
Biophysicochemical Properties
6.5 uM for MLC (isoform 1 at 22 degrees Celsius)
7.2 uM for MLC (isoform 2 at 22 degrees Celsius)
Subunit
May interact (via protein kinase and CRD domains) with mak-1 (via protein kinase domain).
Interacts with MYOM1, MYOM2, tropomyosin and myosin. Interacts with actin, primarily via the PEVK domains and with MYPN (By similarity). Interacts with FHL2, NEB, CRYAB, LMNA/lamin-A and LMNB/lamin-B. Interacts with TCAP/telethonin and/or ANK1 isoform Mu17/ank1.5, via the first two N-terminal immunoglobulin domains. Interacts with TRIM63 and TRIM55, through several domains including immunoglobulin domains 141 and 142. Interacts with ANKRD1, ANKRD2 and ANKRD23, via the region between immunoglobulin domains 77 and 78 and interacts with CAPN3, via immunoglobulin domain 79. Interacts with NBR1 through the protein kinase domain. Interacts with CALM/calmodulin. Isoform 6 interacts with OBSCN isoform 3. Interacts with CMYA5.
Interacts with MYOM1, MYOM2, tropomyosin and myosin. Interacts with actin, primarily via the PEVK domains and with MYPN. Interacts with FHL2, NEB, CRYAB, LMNA/lamin-A and LMNB/lamin-B. Interacts with TCAP/telethonin and/or ANK1 isoform Mu17/ank1.5, via the first two N-terminal immunoglobulin domains. Interacts with TRIM63, TRIM55, ANKRD1, ANKRD2, ANKRD23, and CAPN3 through several Ig domains. Interacts with NBR1 through the protein kinase domain (By similarity). Interacts with CMYA5 (By similarity).
Interacts (via C-terminus) with myosin. Interacts with actin.
All isoforms including Telokin bind calmodulin. Interacts with SVIL (By similarity). Interacts with CTTN; this interaction is reduced during thrombin-induced endothelial cell (EC) contraction but is promoted by the barrier-protective agonist sphingosine 1-phosphate (S1P) within lamellipodia. A complex made of ABL1, CTTN and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement. Binds to NAA10/ARD1 and PTK2B/PYK2 (By similarity).
All isoforms including Telokin bind calmodulin. Interacts with SVIL (By similarity). Interacts with CTTN; this interaction is reduced during thrombin-induced endothelial cell (EC) contraction but is promoted by the barrier-protective agonist sphingosine 1-phosphate (S1P) within lamellipodia. A complex made of ABL1, CTTN and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement. Binds to NAA10/ARD1 and PTK2B/PYK2.
Interacts with FLNC. Interacts with KY.
Interacts with FLNC (By similarity). Interacts with KY.
Homodimer (By similarity). Interacts with TTN/titin (By similarity). Interacts with PNKD.
Interacts with USP25 (isoform USP25m only); the interaction prevents proteasomal degradation of MYBPC1.
Interacts with TTN/titin.
Homodimer.
Interacts with myosin (PubMed:22467859). May interact (via protein kinase domain 1) with ball (PubMed:26251439). May interact (via protein kinase domain 1 or 2) with mask (PubMed:26251439). May interact (via protein kinase domain 2) with Tm1/tropomyosin-1 (PubMed:26251439).
Homodimer. Interacts with TTN/titin and PNKD (By similarity).
Miscellaneous
Determination of the mutation frequency of the unc-22 gene has been used to study the biological effects of short duration spaceflight.
In some isoforms, after the PEVK repeat region there is a long PEVK duplicated region. On account of this region, it has been very difficult to sequence the whole protein. The length of this region (ranging from 183 to 2174 residues), may be a key elastic element of titin.
In asthmatic patients, overexpression promotes actin filament propulsion, thus contributing to airway hyperresponsiveness. Some MYLK variants may contribute to acute lung injury (ALI) susceptibility. Potential therapeutic target in the treatment of burn edema.
Similarity
Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family.
Belongs to the immunoglobulin superfamily. MyBP family.
Keywords
3D-structure   Alternative splicing   ATP-binding   Calcium   Calmodulin-binding   Complete proteome   Cytoplasm   Disulfide bond   Immunoglobulin domain   Kelch repeat   Kinase   Magnesium   Metal-binding   Nucleotide-binding   Phosphoprotein   Reference proteome   Repeat   Transferase   Cardiomyopathy   Coiled coil   Direct protein sequencing   Disease mutation   Limb-girdle muscular dystrophy   Nucleus   Polymorphism   Methylation   TPR repeat   WD repeat   Alternative promoter usage   Membrane   Actin-binding   Cell projection   Cytoskeleton   Acetylation   Aortic aneurysm   Cell cycle   Cell division   Chromosome   Developmental protein   Mitosis   Muscle protein   SH3 domain   Thick filament   Cell adhesion   Ubl conjugation   Zinc  
Feature
chain  Twitchin
splice variant  In isoform e.
sequence variant  In CMD1G; affects interaction with TCAP/telethonin; dbSNP:rs139517732.
EC Number
2.7.11.1
2.7.11.18
Pubmed
2812002    8397135    9851916    7190524    2833427    16765996    + More
18390597    25851606    8202162    8969309    7569978    10850961    11717165    15815621    15489334    8937992    7819249    10051295    12785098    8351016    1582406    8404852    17974005    9645487    12482578    12432079    12444090    14583192    14676215    15967462    16410549    16537787    20634290    7613868    9804419    9782056    11525170    16407954    10462489    12145747    11846417    11788824    12891679    16465475    15802564    17444505    17344846    23033978    25173926    19468303    9440711    16702235    17261657    17242355    21183079    24129315    12381307    20346955    1284247    1534225    9405419    8575746    9160829    10198165    11113114    10536370    15507455    15020676    14702039    16641997    12408982    11976941    14741352    15825080    16835238    16723733    16284075    18710790    18088087    18587400    18318008    19413330    19429448    19826488    20453870    20375339    20053363    20861316    20181817    20139351    21918590    19011151    22015949    22814378    24275569    18462678    21055718    20206623    16141072    10629221    10934048    10731132    12537572    9548712    10669599    9917396    8335002    11062264    12537569    22467859    26251439    16710414    15385448    16177791    7505783    15188056    8227129    2315308    8375400    15057824    1429890    16541075    16501887    22610851    20045868    26661508    7744002    9048664    9562578    16554811    7493026    12787675    15213454    18560154    18374358    18926831    9541104    9541115    10521296    11499718    11499719    12379228    11815426    12110947    12951062    12707239    12974739    14563344    12628722    12818575    15114369    15519027    15582318    15563892    16004897    16199542    18957093    18929575    18403758    20215591    21551322    23840593    26163040    28265379    8576942    9784245    22673903    10532952    19541641    16421571    1400348    15185077    18177667    18515368    8408035    10036188    9857037    22562206   
EMBL
X15423    Z73897    Z73899    CAA33463.1    CAA98065.2    X90568    + More
X90569    AJ277892    AC009948    AC010680    FJ695199    AC023270    BC013396    BC058824    BC070170    BC107797    X98114    X98115    X83270    AF058332    AF525413    DQ248309    X64698    X64699    X64697    X69490    AL713647    AL928681    AL928721    AL928789    CAM23449.1    CAM27059.1    AY130758    BX284605    AAN61517.1    AAN61520.1    AAN61521.1    S57131    X85337    U48959    AF069601    AF069602    AF069603    AF069604    AF096771    AF096766    AF096767    AF096768    AF096769    AF096770    AF096773    AF096774    AF096775    AY424269    AY424270    AY339601    AB037663    AK300610    AK314412    AK314443    AC020634    AC023165    CH471052    BC100761    BC100762    BC100763    BC064420    X90870    EU429481    EU429482    EU429483    GU290042    AK036509    AC108813    BC107027    BC107028    AB026845    AJ238575    AJ238577    AJ271740    AJ400900    AJ400901    AJ400902    AE014296    AF045775    AF045776    AF045777    AF045778    AJ245406    AJ012279    AJ012280    AF135062    AF135167    AF241648    AF241649    BK000146    AY094749    AAC23966.1    AAF47604.1    AAG40155.1    AAM11102.1    BAA90301.2    CAA09971.1    CAB76253.1    CAB93524.1    CAB96426.1    DAA00021.1    AY245430    AL137493    AC103925    CH471067    BC033185    BC131529    AJ621424    AK125322    AP005329    AP005431    BC116183    X69090    AK029282    BC029762    BC039184    U00922    U00923    M31209    X73113    AC020909    CH471135    BC130536    BC136389    X66276    X73114    AK295727    AK296681    AK303401    AL831993    AL832000    AL834249    AC010205    AC090671    AC117505    CH471054    BC092418    BC117217    BC143495    BC143502    BC143503    BC143504    X84075    Y10129    U91629    AY518390    GU324918    AC090582    BC136543    BC136546    BC142685    BC151211    S80778    D43697    U38949    CH473949    AF059576    AF097333    X69089    AC125453    BC052969    D11474    AY578914    AL662911    AE013599    DQ431841    ABD83643.1    Z22866    AJ012072    AC154187    AC154218    AC154717    BC060378   
Pfam
PF00069   Pkinase        + More
PF07679   I-set
PF00041   fn3
PF09042   Titin_Z
PF18362   THB
PF02818   PPAK
PF06582   Titin_Ig-rpts
PF00018   SH3_1
PF00621   RhoGEF
Interpro
IPR003598   Ig_sub2        + More
IPR036179   Ig-like_dom_sf       
IPR000719   Prot_kinase_dom       
IPR011009   Kinase-like_dom_sf       
IPR013098   Ig_I-set       
IPR036116   FN3_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR003961   FN3_dom       
IPR017441   Protein_kinase_ATP_BS       
IPR013783   Ig-like_fold       
IPR013106   Ig_V-set       
IPR008266   Tyr_kinase_AS       
IPR040849   MyBP-C_THB       
IPR004168   PPAK_motif       
IPR015129   Titin_Z_rpt       
IPR015725   MLCK1_kinase_dom       
IPR036028   SH3-like_dom_sf       
IPR001452   SH3_domain       
IPR010939   Titin-rpts       
IPR015726   Ser/Thr_kin_striated-sp       
IPR000219   DH-domain       
IPR035899   DBL_dom_sf       
IPR011993   PH-like_dom_sf       
SUPFAM
SSF48726   SSF48726        + More
SSF56112   SSF56112       
SSF49265   SSF49265       
SSF50044   SSF50044       
SSF48065   SSF48065       
Gene 3D

Ontologies

GO
GO:0031672   GO:0045989   GO:0005524   GO:0005865   GO:0040017   GO:0035095   GO:0045214   GO:0004674   GO:0071688   GO:0051782   GO:0051015   GO:0051371   GO:0019901   GO:0008307   GO:0046872   GO:0006936   GO:0031430   GO:0018105   GO:0060298   GO:0008344   GO:0030018   GO:0005516   GO:0030017   GO:0018107   GO:0030240   GO:0051592   GO:0043621   GO:0042802   GO:0030049   GO:0070062   GO:0060048   GO:0006941   GO:0000794   GO:0097493   GO:0045859   GO:0042805   GO:0010737   GO:0048739   GO:0055003   GO:0005576   GO:0048769   GO:0019899   GO:0035995   GO:0005509   GO:0030241   GO:0003300   GO:0055008   GO:0050714   GO:0010628   GO:0004713   GO:0002020   GO:0050790   GO:0002576   GO:0005829   GO:0031674   GO:0007076   GO:0031433   GO:0007512   GO:0055002   GO:0043056   GO:0030016   GO:0007507   GO:0060419   GO:0021591   GO:0003007   GO:0030506   GO:1901897   GO:0001701   GO:0005859   GO:0001756   GO:0005200   GO:0031965   GO:0017022   GO:0005856   GO:0004687   GO:0032154   GO:0005737   GO:0003779   GO:0030027   GO:0090303   GO:0060414   GO:0071476   GO:0032060   GO:0015629   GO:0005886   GO:0030335   GO:0072358   GO:0051928   GO:0004672   GO:0006939   GO:0001725   GO:0006468   GO:0014820   GO:0005634   GO:0007517   GO:0007520   GO:0007498   GO:0051301   GO:0040011   GO:0007062   GO:0007522   GO:0005863   GO:0035206   GO:0007525   GO:0016203   GO:0007519   GO:0042803   GO:0002074   GO:0019900   GO:0007155   GO:0032982   GO:0005623   GO:0031432   GO:0032036   GO:0032781   GO:0001671   GO:0006942   GO:0055010   GO:0032971   GO:0014705   GO:0097512   GO:0002027   GO:0031034   GO:0008016   GO:0005739   GO:0035023   GO:0036309   GO:0007527   GO:0016301   GO:0007275   GO:0005089   GO:0005523   GO:0005515   GO:0004930   GO:0006915   GO:0016651   GO:0046835   GO:0006281   GO:0006259  

Topology

Subcellular location
Cytoplasm   Expressed at the outer edge of A-bands.   With evidence from 12 publications.
Myofibril   Expressed at the outer edge of A-bands.   With evidence from 12 publications.
Sarcomere   Expressed at the outer edge of A-bands.   With evidence from 12 publications.
A band   Expressed at the outer edge of A-bands.   With evidence from 12 publications.
Nucleus  
I band   Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549).   With evidence from 8 publications.
Nucleus membrane   Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549).   With evidence from 8 publications.
Cell projection   Localized to stress fibers during interphase and to the cleavage furrow during mitosis.   With evidence from 2 publications.
Lamellipodium   Localized to stress fibers during interphase and to the cleavage furrow during mitosis.   With evidence from 2 publications.
Cleavage furrow   Localized to stress fibers during interphase and to the cleavage furrow during mitosis.   With evidence from 2 publications.
Cytoskeleton   Localized to stress fibers during interphase and to the cleavage furrow during mitosis.   With evidence from 2 publications.
Stress fiber   Localized to stress fibers during interphase and to the cleavage furrow during mitosis.   With evidence from 2 publications.
Z line  
Chromosome  
   Colocalizes with ball and mask in Z-lines of indirect flight muscle (PubMed:26251439). In the embryo, localizes across the muscles in a striped pattern positioned at the sites at which muscles are attached to the epidermis. In the larval body wall muscles, localizes to the Z line and is still present as a doublet at the muscle-epidermal attachment sites. During pupa development, progressively forms broad striations at the Z line which become more defined after the pupa eclosion.   With evidence from 12 publications.
Length:
4705
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00259
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  4705
 
 

Population Genetic Test Statistics

Pi
32.940011
Theta
25.314575
Tajima's D
-1.384371
CLR
0.007986
CSRT
0.0772461376931153
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 VTGVQDIITR 96.77 5e-15
28467696 IWSDMASTGTIPIR 96.15 1e-12
28467696 DDGGEPIDSYIVEK 96.30 2e-12
26822097 TVAGFCPK 96.15 6e-11
28467696 NPFDEPGKPGRPEPR 96.00 5e-10
26822097 WSPPIDDGGAPIDHYIVEK 100.00 4e-09
28467696 VIAVIDIR 100.00 4e-09
28556443 IIPNEDGTLITMR 100.00 4e-09
28467696 VSASVGSAEGEIR 100.00 2e-08
28467696 RTDGSCNNIYYPTR 95.65 6e-08
28467696 AGEKFENIKDNVGEK 100.00 6e-08
28467696 IQYAIIDEVWR 100.00 8e-08
28467696 TMVTTGDQITR 100.00 2e-07
26822097 DVGSSVWVK 95.45 3e-07
28467696 VRAENIYGISDPIESKPIIAK 95.45 3e-07
28467696 TDSSIAQQFNVVDKDAPK 95.45 3e-07
28467696 IVDGPSKYPSCTCTR 95.24 5e-07
28556443 VPLDDGGSPILHYVIEK 100.00 1e-06
28467696 VMAAGEHTINNK 100.00 2e-06
26822097 VGQNFDIEVPVAGEPTPTK 100.00 2e-06
28467696 WQPFEANDVQIEFVR 100.00 2e-06
28467696 VSAVNAAGQGPWSQSSDAIR 95.45 3e-06
26822097 FVIKPQSAFCYEGQSVK 100.00 4e-06
28467696 TTVTQTMTISGK 100.00 4e-06
26822097 IIGYWVDKR 95.45 4e-06
28467696 VSAVNAIGQSEPIEIER 95.45 4e-06
28467696 VSAVNAAGPGQPSDESNVFIAKPMK 100.00 1e-05
28467696 ITEPAVETAQDTENSVGTWAK 100.00 1e-05
26822097 MTAHECIVHK 100.00 2e-05
28467696 FVICFFNK 100.00 2e-05
26822097 FIPVAGAMEK 100.00 5e-05
28467696 VVAPTIHSAACR 100.00 5e-05
28467696 AGPGEPSDATKPIIAK 100.00 8e-05
28556443 VTIENK 100.00 1e-04
26822097 IWIDHIIGK 100.00 2e-04
28467696 FVTSYDYAQPIPR 100.00 2e-04
28556443 LEISNVSQTDK 100.00 2e-04
28556443 ATVPNLDEGTEYEFR 100.00 3e-04
28556443 APYDPPSAPGIPK 100.00 0.002
26822097 YAGDDYYFIINR 100.00 0.002
28467696 VSVREPMQTGIK 100.00 0.002
28467696 NDTKEDVFVHQTAIAR 100.00 0.004
28556443 SPFDPPDAPDTPK 100.00 0.005
26822097 VIVMDVPTAPEGPIR 100.00 0.007
28467696 WINSPNVYQK 100.00 0.007
28467696 DPYGGQSGGEYDPYGR 100.00 0.011
28467696 ISTFTSMIDEAFDNR 100.00 0.015
28556443 FDYPVSYLIPGQR 100.00 0.031
28467696 DDGFAQRQFAAK 100.00 0.039
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号