SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16579
Annotation
PREDICTED:_uncharacterized_protein_LOC106720343_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.844
 

Sequence

CDS
ATGACAAAGCCTCGCACACGTCGTCAGTCTCGTCGACAATCCGAGTATTTTGAACCGACAGAGGACGATTCTTCCCCGCCGCCGACTGCATCGGGAAACATTTCCGTCAACGACATGGTCGCCATGATGTCTACGTGGCAACGCAACCAAGAGGAAACGTTTGAGAAACTTCTACATACAGTTCTCAACCAATCGCACCGGTCATCGCCGCCGCCCGCTCAACCTGCACTTGGAAACTTCGCCTCGTGCAAGGCTCGCTACAGCGGAGCGCCAGACGAATCACTTGACGGATTTATAGACGCCGTAGAGGCCTACAAGGAATGTGCAAACGTAAGCGAAACTAATGCACTACGTGGGTTGTCAATGTTGTTAACTCATGAAGCCGCGACATGGTGGCAAGGAGTTAAGACCACCATGAACAAGTGGGACCACGCCCTCACATCCCTAAGAGGATGA
Protein
MTKPRTRRQSRRQSEYFEPTEDDSSPPPTASGNISVNDMVAMMSTWQRNQEETFEKLLHTVLNQSHRSSPPPAQPALGNFASCKARYSGAPDESLDGFIDAVEAYKECANVSETNALRGLSMLLTHEAATWWQGVKTTMNKWDHALTSLRG

Summary

Pfam
PF02210   Laminin_G_2        + More
PF00077   RVP
PF00665   rve
PF17921   Integrase_H2C2
PF03732   Retrotrans_gag
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR013320   ConA-like_dom_sf       
IPR001791   Laminin_G       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000403   PI3/4_kinase_cat_dom       
IPR018061   Retropepsins       
IPR001969   Aspartic_peptidase_AS       
IPR001878   Znf_CCHC       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR005162   Retrotrans_gag_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF49899   SSF49899       
SSF50630   SSF50630       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
151
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04091
Exp number, first 60 AAs:
0
Total prob of N-in:
0.67095
inside
1  -  151
 
 

Population Genetic Test Statistics

Pi
18.067489
Theta
18.937418
Tajima's D
-0.931803
CLR
0
CSRT
0.147342632868357
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号