SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16577
Annotation
PREDICTED:_zinc_finger_protein_883-like_[Amyelois_transitella]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.293
 

Sequence

CDS
ATGAATGTATGCAGAACTTGTCTTGCGGACAAAACTGACAAGGACATATTTAATGTAAAGATGAATAAAGAGTTTAAAAACAAAACTTTTGTTGACATGATGATATTTTGTCTGGATATAATGGTTGTTAAAAATCCAACCATTACAACAAAACTTTGTGCAAAATGCTACAGAAAAATATTATCATTTCATAAATTTAAATCGCTGGCCATAGAAAATGATATTTATTTAGAAAGTCAGTGTACATCTGCCAAGCACCAGATTCCACTCAATAACAATGAGAATGAGATTGGGCCCACACAACAGTTTAGTATACAAATGGTTGACTGTCTCTCTCCTGAAATGAACAACAAAGATATAATATTCAGAGAACAAGTCAAGACAGAAATGGTATCGGCTCATGATGCAGAAAATGACAGTATCGAGTTAGGAAAATCAGAGCCTCCAGAGTTAGAGTCTGATGATGAATACTTGAGTGTAATTAAAACAATTAAAATGGAGTATGGTATGGATGGTAAAGATGCTAAGATCAAACGTAAAAATGCTACTGAAAGAAAATCAAATTCCAAAAAGATAGATAATCCAAAAAATAATTTAAAAATGATGTGCGAGGAATGCGGAATTACTGTAAAAGATTTAAAAGAGCATATGAGACAACATCTTCCTCCAGACGAGAGACCAAGAGTCAATTGTCACCTTTGTGAGGAAACTTTTTCATCGGCCAATTCAAAATACAAACATGTGAGACGTAAACATATGAACATCAAACAGAATTGTAAAATCTGTAATAAGGCTGTCGCAAACCTGAAAGCGCACATATTAGTGGTGCACAATACGGAATCACTGCCGTTTGAATGTATAGCATGCGGACGCGGGTTCATATCGAAGTCGCGCCTTGACGTTCATATGGCGGTGCACACCAAGGATCGCCCTCATAAATGCTCATTTTGCATTAAACGGTTTAGGACTAAGATTTGCATGCAGCTACACGAGCGACAAGTCCACAAAAAGGAGAAGAATCATCTCTGTCAGTTCTGTTCGAAAACTTTTTTCAAAAAATATCACTTACAAGTGCATATAAGAACTCACACGAAGGAGAAACCGTACGAATGCAGCGAGTGCGGCAAGTGGTTCAGCTCGAAGAACGTGCTGAAGAACCACAAGCTCATACACGAGGACGTGAAGAGATTCGCGTGCACGCTCTGCGATATGTCGTTCATTAGAAACGGGTATAGAAAAATCCTAGATTTCTTAGACAGGCTTATTACAAAAACGATATTTTAA
Protein
MNVCRTCLADKTDKDIFNVKMNKEFKNKTFVDMMIFCLDIMVVKNPTITTKLCAKCYRKILSFHKFKSLAIENDIYLESQCTSAKHQIPLNNNENEIGPTQQFSIQMVDCLSPEMNNKDIIFREQVKTEMVSAHDAENDSIELGKSEPPELESDDEYLSVIKTIKMEYGMDGKDAKIKRKNATERKSNSKKIDNPKNNLKMMCEECGITVKDLKEHMRQHLPPDERPRVNCHLCEETFSSANSKYKHVRRKHMNIKQNCKICNKAVANLKAHILVVHNTESLPFECIACGRGFISKSRLDVHMAVHTKDRPHKCSFCIKRFRTKICMQLHERQVHKKEKNHLCQFCSKTFFKKYHLQVHIRTHTKEKPYECSECGKWFSSKNVLKNHKLIHEDVKRFACTLCDMSFIRNGYRKILDFLDRLITKTIF

Summary

Pfam
PF07776   zf-AD        + More
PF00096   zf-C2H2
PF08366   LLGL
PF01352   KRAB
PF16622   zf-C2H2_11
Interpro
IPR013087   Znf_C2H2_type        + More
IPR036236   Znf_C2H2_sf       
IPR012934   Znf_AD       
IPR036322   WD40_repeat_dom_sf       
IPR019775   WD40_repeat_CS       
IPR001680   WD40_repeat       
IPR017986   WD40_repeat_dom       
IPR013577   LLGL2       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR000664   Lethal2_giant       
IPR001909   KRAB       
IPR036051   KRAB_dom_sf       
IPR041697   Znf-C2H2_11       
SUPFAM
SSF57667   SSF57667        + More
SSF50978   SSF50978       
SSF109640   SSF109640       
Gene 3D
PDB
5WJQ     E-value=3.52325e-23,     Score=268

Ontologies

Topology

Length:
427
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.31557
Exp number, first 60 AAs:
0.31416
Total prob of N-in:
0.03555
outside
1  -  427
 
 

Population Genetic Test Statistics

Pi
39.995223
Theta
42.38002
Tajima's D
-0.189199
CLR
0.012353
CSRT
0.31688415579221
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号