SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16569
Pre Gene Modal
BGIBMGA008844
Annotation
Protein_bowel_[Papilio_machaon]
Transcription factor
Location in the cell
Nuclear   Reliability : 4.566
 

Sequence

CDS
ATGTTGGCAAATGGTTTGTACATACACTCCAAAGAGAAGCCTTTCAAATGCACAGAATGTGGCAAAGGTTTTTGCCAGTCGAGGACGTTAGCCGTTCACAAAATTCTACACATGGAAGAATCACCACACAAATGTCCAGTTTGCAGCAGAAGCTTCAACCAACGATCCAATTTGAAGACACATCTATTAACACACACAGACCATAAACCTTATGAATGCAATTCATGTGGGAAAGTGTTCAGACGTAACTGTGATCTTCGGAGACATGCACTTACTCATGCAGTCGGTGACGTACCACCGGGAGATGTGCTAGACGTAGGCGAAGAAGACATCGGAAGACCAGGATCTCCCATTGAACCGGGCTATGATGATGAAGATGCCGAAATTTCATCACCTGAACACTCCCCAGTGCGGAGAGCAAGATCTTCATCAGTGGAAAGCATTGGACAAGAACCACAAAGTGAGGAAAAACCACGACGGCAATCGCCAACACCTGTAGAACGCACCCATTGTCATCACAATGAGCAAAGGGACAGAGCAAGCCCATACACAATGCGTCCACAACACACAGACAAACATCGAGTTTACTCATCAGATGAATACGAAAAACGTCGATACACTACTGAGGAAATAATGGAAAAAGAAATGCGCTACACAGAGATTCCTGAACAACAAGTACGACATCCACAATTACAAATCAGACGAGATTTACACCAGATTCCTCCTCCAGATCCGTCCAAAATGACTCAAATTACAAGTCCGTCCATTGATCCGGGACCTTCTAATATGTACTTGCCTCCATTTAGAAAGAGAAGTCACCCACCAGATATCGGAGATAATCCAAGGTCATGTGCTGCAGTTTACAGAAGCAGATCACCGGAGCCAACCAATCTCACAATGCCTCGGCCTCCAATAGGAAATGGGGAAATGGTAGTCGGTATAGCTCCTACACTTATGGGAATGCCGGCATATCATAAATTTGGATTACCGATGCCACCTCCTCACCCGCAAATCGCATACGGTCCAGTGCCTCACCCTGTTTTGACACCACAACAAACTGTCGCTCAAGACTTGATTGTTAAGCATGCGCCGCCGAAGGACACAATACCTTCAACGTCCACTATAGTTACGAACTGCAAAGATGCAGGTACAAGCATGAAGGATGCAGAGGAATCAAGTTCGTCTTACATAGCGAGTGGCATTAAGAATATCATTGGTATTCAACCGCCGGCCAATCCCAAGCCGGGGACAAGCGGATCCAGTGGACCGAAAAAAGGTTTCAGTATAGAAGATATCATGAGACGTTAA
Protein
MLANGLYIHSKEKPFKCTECGKGFCQSRTLAVHKILHMEESPHKCPVCSRSFNQRSNLKTHLLTHTDHKPYECNSCGKVFRRNCDLRRHALTHAVGDVPPGDVLDVGEEDIGRPGSPIEPGYDDEDAEISSPEHSPVRRARSSSVESIGQEPQSEEKPRRQSPTPVERTHCHHNEQRDRASPYTMRPQHTDKHRVYSSDEYEKRRYTTEEIMEKEMRYTEIPEQQVRHPQLQIRRDLHQIPPPDPSKMTQITSPSIDPGPSNMYLPPFRKRSHPPDIGDNPRSCAAVYRSRSPEPTNLTMPRPPIGNGEMVVGIAPTLMGMPAYHKFGLPMPPPHPQIAYGPVPHPVLTPQQTVAQDLIVKHAPPKDTIPSTSTIVTNCKDAGTSMKDAEESSSSYIASGIKNIIGIQPPANPKPGTSGSSGPKKGFSIEDIMRR

Summary

Pfam
PF00096   zf-C2H2
Interpro
IPR013087   Znf_C2H2_type        + More
IPR036236   Znf_C2H2_sf       
SUPFAM
SSF57667   SSF57667       
PDB
2I13     E-value=2.74855e-16,     Score=209

Ontologies

Topology

Length:
435
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00953
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00343
outside
1  -  435
 
 

Population Genetic Test Statistics

Pi
16.601694
Theta
27.282549
Tajima's D
-1.477767
CLR
0
CSRT
0.0619969001549922
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号