SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16566
Annotation
PREDICTED:_uncharacterized_protein_LOC105386827_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.227
 

Sequence

CDS
ATGGCGACAAAGAGGTCCACAGCATTGCTGGCCACAGCATTGATAACTGTTAAGAATAGTACAGGACATTATACAGTATTGCGCGCCTTAATAGATCAAGGGTCACAGGCTAATTTTATTAGTGAAAGAGCAGCACAACTTTTGAAAGTCAAAGGAACACCCACTAAGGGGACAATCACTGGAGTTGGATCTACACAAACGGAAGTAAATCTGGCAGTCCAGCTTGAAATATTATCTAGATACCAATGCAATTTCAAGCTCAACGTGGAAGCATATGTGATGCCTTCACGTTTAACAACATACTTACCGTCCACAACTATTGCCGACTCCACACTCACCTGGTCGCATTTGAAAGGTCTCAAGCTGGCAGATCCCACCTTTAATCAACCAGGGAGAGTTGATATGCTTCTAGGTGTAGAAGTATATGCAGCCATTCTGAAAAATGAAATTATTCGAGGTCCTCCTGGCTCTCCATGCGCACAACATACAAGTTTTGGATGGATTCTCTTTGGAAAGGTACACAATGACATTGAAGAAAGGAAAATAACAGTAATGCACCACCACATGGATTTTGATGAACTGTTACACACATTATGGGAGTTAGACTGTGATAATCAAAGAAAACTTACACAAGAAGAGGAACTCTGTGAGAACATTTATTATGAAAATGTTAGGAGAGACAATGAAGGAAGATACATTGTGAAATTACCTTTTAAATCATATGTCATACTAAGTACAGAAGGTAATACCAGGGATATAGCACTAAGAAGATTAACACAACTAGAGAGAAGATTACAGAGAGAGATGAAGTTAAGGACAGAATACACTAAAGTGATGCAAGAATATATTGAATTGAATCATATGGAAGAAGTACCAGAAGAAGAATTAGGGAAACCCTCTGTCTACCTTCCTCATCATGCAGTTGTAAAGGATACAAGTGAGACTACCAAAGTAAGAACTGTGTTCAATGCCTCCTCAATGGGATCTAATAATGTTTCCATTAATGATGAGTTACTAGTTGGCCCACAATTGCAAGAAGACATGAGATCATTGGTTATGAGATGGAGACTAAAACGAGTTTGTTTCATAGCAGATATTGAGAAAATGTATCGGCAGATATTGGTTACCAAACAGGATGCAGATTACCAACGAATCTTGTGGAGAATTGATCCAAATTTTAAAGTCAAAGATTACAGATTGCTTCGGGTAACATTTGGAACTGCTTCAGCTCCGTTCCTTGCTGTAAGAACTCTACAACAAGTTGCAGAAGATGAAGGCAAAGATTTCCCTGAAGCAGCTAGAATGATTAAGGAAGACTTCTGGATGGATGACTTATTATCTGGTAACGATACAGTAAGTGAAGCCATTGAATCAGCAAGAAATGTCAGTGACATTTTGAATCGTGGCGGTTTCAAATTACAAAAATGGTCTTCTAACAGTATTGAATTTATGAAAAATATTTCACCTACAGAAAGAAGTACATTGATAAATGTGGATATGAACCTGGGAGGAACTGTTAGAACATTGGGGTTATCATGGAATATAGGAGATGATGTGCTACAGTATAATCTTAATTTGCCAGAAGTGCCACTTACCATTACTAAGAGAAGTATACTTGCTGAGATACAACGCTTATTTGATCCACTTGGTTGGATAGCACCTGCCTTGTTACCTGGAAAACTAATAATACAAAGACTATGGTTGAAAAGACTTACCTGGGATGAAGAAGTAGACTCTGAAACTAAAAGAGATTGGTTAGAGATGAGAAACAACTTAAATTATTTAAAGGAAATTAAAATACCACGCTGGTTACTTATTACTAGTGATGTCATAGAAGATGTGTCAATACATGGATTTTGTGATGCATCAACAATTGCATATGGAGCAGTTGCTTACCTGAGAGTCAAAACTTACAATAATGAATATAAAACTATGCTGATAGCAGCGAAGACTAGAGTCGCACCTGTTAAACCAGTCTCACTGCCCCGTTTGGAACTGTGCGGTGCGGTGTTATTATCAAAGCTCTTGAAACACATCAGTCGTGCTACACGGATACCAAGGAAACAAATCTTTGCTTGGACAGATTCTACCATAGTACTATCATGGCTTACTGGAGACCCGACGAGATGGCAAACATTTGTGAGAAATCGTGTAGTAACAGTGCTTGACAATATTGGAAATGCATGGTATCATGTACAGTCTCAAGACAACCCTGCAGACATAGCATCAAGAGGAATGCTTCTTTCAGATCTCAAAGAATTTAGTTTATGGTGGAACGGCCCTAAATGGCTCACCCATGAAGAAATATTGATGTCTCGCGGAGATAATATTTCTACTGACCTAGAGTTGAGAAGAACAATTATCAATACAAACATAAAAATAGACAATAATCATAATGAAGGAAATTATATACACAATCAATTTGAAAACTTTAACAACTTGATGGAACTACAAAGAACTATTGTGTACTGCAAAAAATTCTTGAATTTTAAACGAAGTAGCGATAACATTAGTACAAAGTGCTTCAGCCCACTGGAGTTAACAGAAGCTCTTGAAACATGTGTGCGGTTAGCACAACATAATGATTTTGAACATGAAATCCACGATTTGTTACAAGGGACTGGAGTAAGTAATAGAAGTGTACTGAAGAATCTCAATCCTTATCTAGACAAGAAAGGTCTTCTCAGAGTAGGCGGTCGATTACGAAATGCGGAAATGGAAAATGACGCTAAATATCCTATGATCATAAGTCATAAGAACCCCATTGCAACATTGATAGTTAGTGATGCACACTTGAAGACACTTCATGGAGGACTCCAACTCACAATGAATTTTGTTAGATCAAGATTCTGGATCATAAGAGTAAAATCATTAATATCAGCTACAATACATAAATGTTTAATATGTGCAAAGCAGAAGGCTAAGGTCCGACACCAACTCATGGGAGACTTACCTGCAGCACGAGTAACACCCACTCGTCCATTCCTACACTCAGGAGTAGATTTTGCAGGCCCACTACAGATTCTGGTTTCCAGAGGAAGAGGCATGAAATGCACTAAGGGATACATATGTATATTTATATGCATGTCAACTAAAGCAATCCACTTGGAACTGGTTGGAGATTTAAGCACCGAGTCATTTTTAGGATGTTTTAGAAGATTTGTTGCCAGAAGAGGTCGATGCTCCCACATTTGGAGTGATCAAGGTACAAACTTTGTAGGAGCCAGTAAAGAATTAGCTAAAATGTGGCAAGAAGCAAAATTAAGTATACCTGAAGATTTAATAAACATTTTAGCTGAAGATGGAACCCATTGGCACTTTAACCCACCTTATAGCCCAAATTTTGGAGGTTTATGGGAAGCTGGGGTGAAATCTATAAAATATCACTTAAGAAGAATTCTTGATAGAACACTTACCTTTGAAGAGATGTCCACCACACTGTGCCAGATTGAAGCCTGCTTAAACTCACGGCCACTATGTCCAATAGATCATAATGATATTGACAATTTAAATGTACTTACTCCTGGACACTTCCTCATTGGAGAAGCTCCAATCAATATACCTGAACCAGATCTTAGCCAAGTGAATGTAAACAGACTGTCTAGATGGCAACATACTCAGAGGATACTTCAAAACTTTTGGCATAAATGGAAGACGGAATATCTCACACGTTTACAACAAAGACCTAAATGGTTAACTTTAAAGGATGAGTTTAAAATTGGAGAAGTGGTTCTGATTAAGGAAGATCACCTTCCTCCGGGTAAATGGGCCTTAGGTCGCATAGTTGAAAAATATCCTGGCTCTGATAACATCTGTAGAGTTTACAGCTTAAAATGTTGTGGTAAATTGATTAAGAGATCCATTAGTAGACTGTGTAAATTGCCAATTAATGAATAA
Protein
MATKRSTALLATALITVKNSTGHYTVLRALIDQGSQANFISERAAQLLKVKGTPTKGTITGVGSTQTEVNLAVQLEILSRYQCNFKLNVEAYVMPSRLTTYLPSTTIADSTLTWSHLKGLKLADPTFNQPGRVDMLLGVEVYAAILKNEIIRGPPGSPCAQHTSFGWILFGKVHNDIEERKITVMHHHMDFDELLHTLWELDCDNQRKLTQEEELCENIYYENVRRDNEGRYIVKLPFKSYVILSTEGNTRDIALRRLTQLERRLQREMKLRTEYTKVMQEYIELNHMEEVPEEELGKPSVYLPHHAVVKDTSETTKVRTVFNASSMGSNNVSINDELLVGPQLQEDMRSLVMRWRLKRVCFIADIEKMYRQILVTKQDADYQRILWRIDPNFKVKDYRLLRVTFGTASAPFLAVRTLQQVAEDEGKDFPEAARMIKEDFWMDDLLSGNDTVSEAIESARNVSDILNRGGFKLQKWSSNSIEFMKNISPTERSTLINVDMNLGGTVRTLGLSWNIGDDVLQYNLNLPEVPLTITKRSILAEIQRLFDPLGWIAPALLPGKLIIQRLWLKRLTWDEEVDSETKRDWLEMRNNLNYLKEIKIPRWLLITSDVIEDVSIHGFCDASTIAYGAVAYLRVKTYNNEYKTMLIAAKTRVAPVKPVSLPRLELCGAVLLSKLLKHISRATRIPRKQIFAWTDSTIVLSWLTGDPTRWQTFVRNRVVTVLDNIGNAWYHVQSQDNPADIASRGMLLSDLKEFSLWWNGPKWLTHEEILMSRGDNISTDLELRRTIINTNIKIDNNHNEGNYIHNQFENFNNLMELQRTIVYCKKFLNFKRSSDNISTKCFSPLELTEALETCVRLAQHNDFEHEIHDLLQGTGVSNRSVLKNLNPYLDKKGLLRVGGRLRNAEMENDAKYPMIISHKNPIATLIVSDAHLKTLHGGLQLTMNFVRSRFWIIRVKSLISATIHKCLICAKQKAKVRHQLMGDLPAARVTPTRPFLHSGVDFAGPLQILVSRGRGMKCTKGYICIFICMSTKAIHLELVGDLSTESFLGCFRRFVARRGRCSHIWSDQGTNFVGASKELAKMWQEAKLSIPEDLINILAEDGTHWHFNPPYSPNFGGLWEAGVKSIKYHLRRILDRTLTFEEMSTTLCQIEACLNSRPLCPIDHNDIDNLNVLTPGHFLIGEAPINIPEPDLSQVNVNRLSRWQHTQRILQNFWHKWKTEYLTRLQQRPKWLTLKDEFKIGEVVLIKEDHLPPGKWALGRIVEKYPGSDNICRVYSLKCCGKLIKRSISRLCKLPINE

Summary

EMBL
ODYU01008608    SOQ52337.1    KQ458473    KPJ05885.1    KQ460036    KPJ18393.1    + More
LNIX01000036    OXA39969.1    GEZM01060254    JAV71154.1    LBMM01008324    KMQ88972.1    LBMM01007859    KMQ89359.1    LBMM01008464    KMQ88855.1    LBMM01010417    KMQ87475.1    LBMM01010405    KMQ87487.1    LNIX01000002    OXA60848.1    GAMC01003146    JAC03410.1    LBMM01009964    KMQ87756.1    OXA59522.1    LBMM01009551    KMQ88039.1    AY180917    AAN87269.1    LBMM01006539    KMQ90520.1    LBMM01009645    KMQ87967.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    LBMM01009688    KMQ87939.1    LBMM01012188    KMQ86362.1    LBMM01009888    KMQ87813.1    GBBI01004211    JAC14501.1    NWSH01000070    PCG79985.1    LBMM01009210    KMQ88303.1    ABLF02022040    ABLF02056888    GFTR01008874    JAW07552.1    GEZM01066272    JAV68024.1    KK114194    KFM61875.1    AJ487856    CAD32253.1    GEHC01000864    JAV46781.1    GALX01004947    JAB63519.1    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    JXUM01030959    KQ560903    KXJ80414.1    GGMS01004301    MBY73504.1    GGMR01020322    MBY32941.1    JXUM01113346    KQ565681    KXJ70776.1    GGMR01005535    MBY18154.1    LBMM01009202    KMQ88311.1    GEZM01085145    GEZM01085143    JAV60187.1    GBBI01004139    JAC14573.1    GBBI01004140    JAC14572.1    GGMR01010750    MBY23369.1    ABLF02004142    GEHC01000869    JAV46776.1    LBMM01011283    KMQ86917.1    GGMS01010815    MBY80018.1    QOIP01000009    RLU19024.1    CR954257    CAJ14165.1    GEZM01054765    JAV73413.1    LBMM01010986    KMQ87097.1    ABLF02041590    LBMM01009496    KMQ88090.1    GEZM01021505    JAV88969.1    ABLF02041505    EF426679    ABP48078.1    LBMM01009212    KMQ88302.1    GEHC01000898    JAV46747.1    ABLF02041731    GGFJ01000337    MBW49478.1    GGMR01002340    MBY14959.1    KQ460500    KPJ14270.1    GGMR01020500    MBY33119.1    ABLF02042806    GEZM01018629    GEZM01018623    JAV90127.1    GBYB01000873    JAG70640.1    ABLF02042264    GGMR01000448    MBY13067.1    ABLF02065856    GANO01004788    JAB55083.1    ABLF02016109    ABLF02016113    U23420    AAB03640.1    GL769615    EFZ10365.1    GEHC01000894    JAV46751.1    GAKP01007887    JAC51065.1    GEZM01012999    JAV92824.1    LNIX01000011    OXA48427.1    GGFL01004049    MBW68227.1    KQ459312    KPJ01687.1    GGMR01018294    MBY30913.1    GAKP01010103    JAC48849.1    GGFJ01000364    MBW49505.1    GBYB01004444    JAG74211.1    ABLF02006304    ABLF02036268    ABLF02024568    KQ458793    KPJ04955.1    GEHC01000877    JAV46768.1    LBMM01009863    KMQ87831.1    ABLF02030854    ABLF02067347    GAMC01020552    JAB86003.1    GGMS01006802    MBY76005.1    LBMM01009941    KMQ87772.1    NWSH01001945    PCG69607.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF05380   Peptidase_A17
PF18701   DUF5641
PF00078   RVT_1
PF00665   rve
PF12259   Baculo_F
PF00230   MIP
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR022048   Envelope_fusion-like       
IPR000727   T_SNARE_dom       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF81338   SSF81338       
Gene 3D

Ontologies

Topology

Length:
1298
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.397150000000001
Exp number, first 60 AAs:
0.33028
Total prob of N-in:
0.01590
outside
1  -  1298
 
 

Population Genetic Test Statistics

Pi
3.503667
Theta
12.627215
Tajima's D
-0.967352
CLR
0
CSRT
0.142292885355732
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号