SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16554  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004550
Annotation
PREDICTED:_epidermal_growth_factor_receptor_kinase_substrate_8-like_isoform_X3_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.603 Nuclear   Reliability : 1.959
 

Sequence

CDS
ATGGCGATGCGTGGAGCTGGGGTGGCTGGGAGCGGTACCTCTCGGTCCCGGGGGGAAGCTCAGCGAACCCTGGACGAGTTTGATGAGCTAGCAGGCATACGAGGGGGTGAGGGAGGGGAGCGGTCAGTCTACGTGCTGGAACACCTGGCCACCTTCACAGTGACGAGAGAGACGGGGATTGTCTACCCCGCGGATGGCATGAGGAGGCTGCTGCAGCTGGAGAAAACCAATGGAATTTGGAGCCAAAAGATGCAATTGTCTTTGGAAGGACAGTGGGTTCTGGTTATGGATTACGAAACTGCTTCAGTGATGGAGCGGTTTCCGGCTTCGTGGGTTCATTCACCCACCGCATTCACGTCTCCAGAACCAGCTGAGCTCTACAACAACGTGCTCGCCTTCGTAGTGGGAGCTCCTGCGTCACCGGCAGCCGGCTCCCACCAGGAGGGAAGGAGAGAGCTACATATATTCCAGTGCCATGACGTCAGCGCGCAGACACTCGTGGAAGAGCTTAATGCTCTAAAGGGTGTCGGTCGAGACGGTTCCGCTGACGGAGGCCGCGACTTCATTATCGAGCGGGAGCGGGAGCGCGAGCGAGAAACAGAAAGCGACAGACCTCAGAGACAACAAATGTCCGCGCAATTGGGCCGCGACAGAGAAAGAGAAAGGGATAGAGACAGAGACCGTAGCGGCTCTGGGGGCGAAAGAGACGACGCTTCATCCACAGGCTCCGAGCGTCTATACGAACAAGACATCGCCATATTGAACCGTTGCTTCGACGACATAGAGAAGTTCATAGCAAGATTACAGCATGCGGCTGCAGCTTCAAGGGAATTGGAGAGGAGGAGAAGGTCCCGAGGAGGCAAGCGAGCGGCGGCTGGTGAAGGAATGCTCGCAATGAGAACCCGTCCTCCGCCAGAGCGTGATTTTGTCGATGTTTTGCAGAAATTTAAGCTGTCCTTCAATCTGTTGGCACGTTTGAGAGCTCATATCCATGACCCGAATGCTCCAGAGTTGGTTCATTTCTTGTTCACACCGCTGGCGCTGATTGTGGACGCAGCACAGGACGTCGCCGACGGCCGTCTCCCAGCTAGGGTTGTGCAACCTCTCCTCACGAGGGAGGCCTTGAACCTTCTGGCGAATTGCGTGACAAGCAAAGAAACTGAACTGTGGCACTCATTAGGAGACGCTTGGCTAATACCCAGGGAGCAATGGAAAACACAGATACCACCATATCAACCGGTTTTCATGGACGGATGGACTCCAGATTACCAAGTCGATGACCAACCTTTACGCAGGTCATCGCCCAGACGCAGCGAGCTGGGCAGGGGTACAATGGAACGGGGCGTGGAAAGGAGCGAGGGCGGGCAGGTGGCGGGTTTCACGTTCGAACGAGAGGAACCCGAGATATACAACGAGCAATACGCTCCGTTCGCCAGAAATAACTTGAGACCACCAATCGGCCGCGAAGATTCGGGCTCCGCTGCCTCATCGCCCGACAGAGAGCCCCCGTATCGCCCCGCAGACAGAGATGAAGCAGATTTGGGTGAAGCGTGGGCCCGGGGCGTTGCGGCCCGGGGAGGCCGCGTTGTGCGCGTCACCTACCCTCGCACTGCAAATAACGATAAAGAATTAACTGTCGTTAGGGGAGAGTATTTAGAGGTTCTAGATGATTCGAGAAAGTGGTGGAAGGCACGTAACAGACGCGGCGTGTCAGCGCACGTGCCACACACCATCGTGGCTCCCGCGTTTTCGCCGCCTTCGTCACCACACCTCTACCCTAATCCGATATACACACATTACCAGGATGGCGGGGGGAGAGCTTCGGGCGGCAGCAGTCCCACTGCGGCACCGGAGAAACCAGCGCCAAAGATTGAGGCGGCTGCTCCACCGCCCCCGCCGCCGCCTCCTCCACCCCCGGAGCCGCCGTCACCGCCACCCATCAAATCTGATACTTTGAAATCCACCAAATCGATAATGAGTACTGGCGGCAGTCTCCACGATGAACTGAAGCTAGTACTGCCCCAGATACAGCAAAGAAGAAACAAACTCGACATCAAGAAGACTCCAGATATATTCATTGATCAGAAATCGAATCCGGACGAGGTTGTGGAATGGCTCGAAGCAAAGGGTTTCAGCAATGCCGCCAACGCCAGCTGA
Protein
MAMRGAGVAGSGTSRSRGEAQRTLDEFDELAGIRGGEGGERSVYVLEHLATFTVTRETGIVYPADGMRRLLQLEKTNGIWSQKMQLSLEGQWVLVMDYETASVMERFPASWVHSPTAFTSPEPAELYNNVLAFVVGAPASPAAGSHQEGRRELHIFQCHDVSAQTLVEELNALKGVGRDGSADGGRDFIIERERERERETESDRPQRQQMSAQLGRDRERERDRDRDRSGSGGERDDASSTGSERLYEQDIAILNRCFDDIEKFIARLQHAAAASRELERRRRSRGGKRAAAGEGMLAMRTRPPPERDFVDVLQKFKLSFNLLARLRAHIHDPNAPELVHFLFTPLALIVDAAQDVADGRLPARVVQPLLTREALNLLANCVTSKETELWHSLGDAWLIPREQWKTQIPPYQPVFMDGWTPDYQVDDQPLRRSSPRRSELGRGTMERGVERSEGGQVAGFTFEREEPEIYNEQYAPFARNNLRPPIGREDSGSAASSPDREPPYRPADRDEADLGEAWARGVAARGGRVVRVTYPRTANNDKELTVVRGEYLEVLDDSRKWWKARNRRGVSAHVPHTIVAPAFSPPSSPHLYPNPIYTHYQDGGGRASGGSSPTAAPEKPAPKIEAAAPPPPPPPPPPPEPPSPPPIKSDTLKSTKSIMSTGGSLHDELKLVLPQIQQRRNKLDIKKTPDIFIDQKSNPDEVVEWLEAKGFSNAANAS

Summary

Pfam
PF08416   PTB        + More
PF18016   SAM_3
PF00018   SH3_1
Interpro
IPR033928   EPS8_PTB        + More
IPR011993   PH-like_dom_sf       
IPR036028   SH3-like_dom_sf       
IPR039801   EPS8-like       
IPR001452   SH3_domain       
IPR035462   Eps8_SH3       
IPR013625   PTB       
IPR041418   SAM_3       
IPR013761   SAM/pointed_sf       
IPR006020   PTB/PI_dom       
SUPFAM
SSF50044   SSF50044        + More
SSF47769   SSF47769       
Gene 3D
PDB
1WXB     E-value=2.43111e-07,     Score=134

Ontologies

Topology

Length:
718
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00632999999999999
Exp number, first 60 AAs:
0.00125
Total prob of N-in:
0.00043
outside
1  -  718
 
 

Population Genetic Test Statistics

Pi
2.729979
Theta
2.800565
Tajima's D
-1.600909
CLR
0.000058
CSRT
0.0363481825908705
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号