SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16552
Pre Gene Modal
BGIBMGA004549
Annotation
PREDICTED:_uncharacterized_protein_LOC101735730_isoform_X1_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.84
 

Sequence

CDS
ATGGACTCGGATTACTCGCTTCCTTTCAACCCCGCAATAGTCGAGGAGTTGTCACACGACGATGGTGAAGCACGCAATGGAACACGAACAACAGAACCAGGTGACCGAGGCGTACTTCGTGATGTACTCGAGGAGCAGTCCGTGCGGGAACTCGGCCTGTCAGCACATCCGGGATATCACGCACTACCACTGCACTTGGCGGCTAGATTCGCTCCCAACTTCACACCTCAACTAACTGCTCAACTACATCCGAACATGGCTGCCCAGCTCGGCCAAGTTCCAAGTTTGCCAAATCTCCCTCCGAACTTGGCTCAATTGGCCCAAATGGCGCCGAGCCTTGGACCGCAGCTGACACCAAACCTGCAGGCGCAACTTAACCTTGGGCCCAATCCCGGAGTGGTGCCTCAGCAAGTCAATCCCTCAAGTTCCCTGGACGAAATGTTTAGTAGGAAGCGAGGAAGGCCGCCGAAGAATAGAGTTGTCGAAGTCTGGACTGACAATATAACACCTCAAGCGATATTCACGTCATTCAAGCTCCCTAAAAGCAATCAGATGCCTTCGGTTATACCGTCGCCCATCATCGCCACGGTCGAAGAATTTCCGTACTCCGTGCTGGCAACGCATAAGCACGGACGCGGCACTCCTGTCATCAAGAGTGAATCCGAACAAGATAAATCTTTCGAAGAAGCCAGAGATTACTCTTTAAAAGAGAGAGCGTCAGTGGACAGTGTAGGTTCGACGAAAGAGGCCGATATATACGCAGCAACGAATTTCACAATCAAAAGCGAATTCGAAAGGGAACAAGATAACGTTTCTGTAGTAAAAGCGACGGGCACGTTTTACCCGTCGTCACATTTAAGAAGCAACGCTTCCTCTCCATCCCCGAGGAGCATCTACGATGCGTCTCCATCGAAAGACCTCAAGCCTCGCGTAGACTTTGAGAAGAAGGCCTTCGAACCTCACAAGAGTACGGGACCGACTATACCACCCTCGTGCCACGACCAGACCTGTCCTTTGAACAAGTCTGCTGGAGGGATGAACCTCCACTATCACTGTCCTCATTGTAGTCAGGCGTATGTAGACCTGAAGCTACTGTTCAGTCATATGATGAAGAAGCACAGTAACAACGAGTCAGCGCCCGCCGGATTGGCAGCCACTAAGGAGACGTTGGAGAGGGAGTATCCTGAAATATCGATTCTGCCCTCGACGGCTTCTTCATCAGCAAGCCAGGCCCCTTCACCCAGCCAGAGACAACCCAACCCTGCTGATCAGGTCCAAGCTGTCCACAGTCTCCTCCTACAGCAGTACCTAGCCGGGGGCCGGAAGGGCAGTCTCCAGGACCAGCTGAAGATGCAGCAGCAGTACACAGCCTCTCTGGCGGGCCTGCCGGGCCTGGCTCAAGTGGCCCTCTTCTCTCAGGGCGGGCCTCCGTTTCCGCTTTACCCAACGATGCTGTACCCACCGGATCTGCTACTTGAGCAAAGTCTCATTCAGGGACACGGCCTGCACCCCGGGATGGACAAGGAAGCCGAAATGATCGCTAAATCTCGTCGGACGCACACGGCCCGCGGTCCACACATGCGCGTACTGAAGGACGAGCCCATCCCCGAGGGCTACCTGCGATTCAGATTCAACGAGGACTGCGCTTATCAAAACTGCGGATACAGGGAACATCAAACTCACTTCCACTGCACTCGCAAGGACTGCGGATATTCCTTCTGTGACAAGACCAGATTCGTGCAGCACACCGCCAGACATGAGAGATTGGACACGTTGATGGGAGGTGATTTCCAGCAATACAGAGCCAACGTCTATTGTCAGAGGCCGGAGTGTCCGCATGCTTCCACGTTCGGCCAGAACAAGGCATCGCATTTCCACTGTCTCAAGTGCGACTTCGTTTGCACGGACACAAACAAAGTGGTCGCTCATCGTCGCCAGCACCAGAAGCTCGATTCCATTCAAGCGGCAGGCTTCGAGAAATTTCCGCCCAGCAAAGGTTGTGGATACGAACCGCAATGTATTCACAGTAAGAAGCAAACCCACTATCACTGTCTTCAGTGCGGTTTCGCTGTGCTTGGCCTCTCCCAGATGACGTCACACAAGTACAAACATCAAGAAGCAAATCTAGGACCCTCGACCAGCGGCACCAACTGA
Protein
MDSDYSLPFNPAIVEELSHDDGEARNGTRTTEPGDRGVLRDVLEEQSVRELGLSAHPGYHALPLHLAARFAPNFTPQLTAQLHPNMAAQLGQVPSLPNLPPNLAQLAQMAPSLGPQLTPNLQAQLNLGPNPGVVPQQVNPSSSLDEMFSRKRGRPPKNRVVEVWTDNITPQAIFTSFKLPKSNQMPSVIPSPIIATVEEFPYSVLATHKHGRGTPVIKSESEQDKSFEEARDYSLKERASVDSVGSTKEADIYAATNFTIKSEFEREQDNVSVVKATGTFYPSSHLRSNASSPSPRSIYDASPSKDLKPRVDFEKKAFEPHKSTGPTIPPSCHDQTCPLNKSAGGMNLHYHCPHCSQAYVDLKLLFSHMMKKHSNNESAPAGLAATKETLEREYPEISILPSTASSSASQAPSPSQRQPNPADQVQAVHSLLLQQYLAGGRKGSLQDQLKMQQQYTASLAGLPGLAQVALFSQGGPPFPLYPTMLYPPDLLLEQSLIQGHGLHPGMDKEAEMIAKSRRTHTARGPHMRVLKDEPIPEGYLRFRFNEDCAYQNCGYREHQTHFHCTRKDCGYSFCDKTRFVQHTARHERLDTLMGGDFQQYRANVYCQRPECPHASTFGQNKASHFHCLKCDFVCTDTNKVVAHRRQHQKLDSIQAAGFEKFPPSKGCGYEPQCIHSKKQTHYHCLQCGFAVLGLSQMTSHKYKHQEANLGPSTSGTN

Summary

Interpro
IPR013087   Znf_C2H2_type        + More
IPR040373   CASZ1       
IPR017956   AT_hook_DNA-bd_motif       

Ontologies

Topology

Length:
717
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00342
Exp number, first 60 AAs:
3e-05
Total prob of N-in:
0.00014
outside
1  -  717
 
 

Population Genetic Test Statistics

Pi
6.422493
Theta
22.076245
Tajima's D
-1.305233
CLR
0.770853
CSRT
0.0858957052147393
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号