SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16543
Pre Gene Modal
BGIBMGA013407
Annotation
PREDICTED:_dual_serine/threonine_and_tyrosine_protein_kinase-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.763
 

Sequence

CDS
ATGGCCGGTGGGTGTGCGTGGTCGCGACGTGTGGGCGCCCGAACGAGGACTCTTAGAGGATTAGTTCGGGACACACAGCGGGCTCTGAACGACGTCTGCGATATATTGAATTATGATCCGGATATCCTGGTAACAGTTCAAGATATAGGCAACCAGTTAGCGAGAAGCACAGCTATCGTAGTACTAGGGAGCACGCCGTCGGCCAAGGCTAGACTTTTGCACTGCTTGTTGGGACGACAGCTGCTGCCGGATTCTCCGCCGAGAGGATGCAGATGGCTTCGTATCCAGTACGGGAGCACAACCCAGGTCCACCTGACCCTCGGCAACTCAGAGTTCGAGCTCGTCGAAGAGTTGGAGTGCAACAAGCGTCCCTGGGAGACGCTGCCCGTTGAGGATCTCCTACGACGAGACAACGCCGACGCCTCAACGATACTAGAAGTGGAAATCAACAATCAATTCCTAAGAGACGGCCTCAAGATCATCATACCTCCCGACATCAGCGTCGAGCCAGGCCTAGCAGACCACCTGACCCTGAAGAAGCTCCACCATGAACTGTACACGAAAAGAGAAAGCATCTTGAGGAGCATCAACCCGGTATACCTGTACGGTATCGACAGAATGGGAAAGAACATCTTCAGCGATAATATAATGAATTCGCTTGTGGTGTCGAAGAGCGAAGAAGACTTTTGGGACAGTTTCAATCTGTACTGCATGAGCAAGAGTGAGAGGGAGAGAGAGAAGACTGAGATCGTTATAGATAGAGAGGACAGAGAGTGGAATTCAACGAGGGAGCCTTGTGTTTTCAGTGGGGAGAACTGCCTGGACCTGCACCAAATCAAGGAGATAAATCCGAACGCTCAAGTGATGTTCGTATTGTTCTCGGACAGCGCGGAGACGTGCGGCGCGGGGCGGGGGGGCGGCGCCGCGCGGCTGCTGCTCGACGTGGAGGCGACGGAGTCCACCGAGGGCTCCGTGTGCTGCGACGAGCTGCCGGAGAGCGACCAGGGCCTGGTCCAGATACGGAATAATAACGGGTCTCCGACATCGAAAGCTCAGGACGACAGACGACTGCACGAAGCACAAATAGCTTTTTTGAACGAGCTTCTCGACCAGTGGGAGCTTATGTCGTCCCGGCCGCAAAAGCACCAAGTCAAGAGCCAGTGGATGATCCTGAACGAGCTGGCGGTGCACCGCGGGGGCGAGGGCGGGGCGGGCGGCGCGCGGGGGGCGGGGTCGCGCACGGCGCTGCTGGGGGCCGTCGTGCGCTTCGCCACTGACACCGCGCTGGCCGACCTGCTGCAGCGCGCCACCAGGCTCGGCGAGATCCACGTGAAGCTGCTCCAGCAGTTCATCCTGGCCTCGTACGACATGGCCCGAGAGCTGCAGGTGGTGCCCAAGAAGATCCAGTACGTGGCACGGCAGGAGCAGCAGCTGTATGAGACTATACACGAGAAGTTCACCGAGGGTGACAAGAAGCACGAGCTGCTGCGGATAATGCAGGACGTGCTGCAAGAGATGAAGCACGAGATCAACAACATGGACTGGAGCGTCGACGACCTGCCGTGCCACCAGGACCACCGCTTCACCGTGTCCAGCTCTACGTTCTACTCGGCGCGGCCGAGTCCGGAGCACCCGCGCGACTGGTCGCGGAGCCCTGACCCGTCGGACGGCGAGGAGGCCGTCTCCTACGACACCTACAACTTCGACGACTACGAGATCATCCAGCAGGGCCTGGATACCTTCGGGGACTCACTTCCGATGAGGGTCCGACCCGAGGAGGACGCGTCCAAGTTCAACAACATCAAGATCGAGAATGAATACGAGTCGTGCTCCGTGTCGTCGGCGCGCAGCGGCTGGGCGGTGGCGACCGGCAGTGACGTCACCACCTGCACCAACAACACCAACGTCTCCATCAAGCAGGCGTCGCTGGACGTGCAGCAGACCGTGCTATCGAAGCTGAGCCGAAAAATTAGTTTGAAACTGGTGAAGTTCGTGGATTGCCTCAAGAACACGTACTTCGGTACGCTGCAAAGATGTCTAGAATCCCTAGAATCATCTTGCAGACAGGAGTTGGGCGGTCTACCGGCCAGTGAAGCAATGAGGCAGCTGCTCTCGGTTGCCTGGCAGGTGGATCTCCAGCCCTGTGCCTCCTTCTCTGTACTGAGGACTCTAATCGAATCACTGAGACGTCTTTTGCATAAATTGAAGATAGTGAGCGGTGAAGATGATGACGCGTGTTGCGTGCTGAGTCCGGTGTGGAGGCGCCACGTGGCGATGCACGCCGCGCACTCGCTCAACCCGCACCGCCTCGCCAGGCTCATATCCACGCAGATCCTAGAGAAGCTAAGCACGGCTCACGAACGCTATCAATCGGCGCTGGCGTCCCTCGAGGCGGCCCTGACGGGGCGCCTCCACCACACCGAGGACGTGAAGCTGGCCATCAGGAAGAAACACGCCCCGTCCTTCGCCAGACTCTGCCTCGAGAGCACGTCCCTGTGCGACATGCTGATGCACGGCGTTCCGGAGCTGGGCAGGGAGATCGGTCGCGGGCAGTACGGCGTGGTTTACGCCGTCCGCGGCAGCTGGGGGGGCCACTCGCCGGTCGCGGTCAAGTCGGTGCTGCCCACGGACGAGCGCCATTACCACGAGCTGGCCATGGAATTCTTTTATACTAGGAGTATACCGGCGCACCCCCGCATAGTCCGCCTGTACGGGTCGATAGTACAGCGCCAGAGTTCTGGGCCCAGCGTGCTGCTGGTGTCCGAGAGGAAATGTCGGGATCTGCACGCGGCCGTCAGGGCGAAACTCCCCTTCTCCACTCGGATGAGGATCAGCTGCGATATCGTCGACGGCATCCGCTACCTGCACTCGCTGGGTCTGGTGCACCGCGACATCAAGACGAAGAACGTCCTCCTGGACGGGGCGGACCGCGCGGCGCTGTCGGACCTCGGCTTCTGCACGGCCGGCGCGCTCATGTCGGGCTCCGTGGTGGGCACGCCGGTGCACATGGCGCCCGAGCTGCTGGCCGGGGACTACCACGCCTCCGTCGACGTGTACGCTTTCGGGATCTTGTTCTGGTACGTGTGCGCTGGTGACATAAAGCTACCGTCAGCTTTCGAAACTTTCCAAAACAAGGAACAGCTTTGGAGTAAGGTTAAAAGAGGTCTGAGACCTGAACGTCTACCTCAGTTCTCGGACGAGTGCTGGGAGATCATGGAGTCGTGCTGGGCCTCCGAGCCCTCCCAGCGGGCGCTCCTCGGGGACGTGCAGAACAAGCTGGAGAGGATCTTGGAGCAGGCTCTAAAGGACGAAAAGTCTCCTGGCTACCTCGCCCCGGACGAGCCAGACCTTAACGACGACTAG
Protein
MAGGCAWSRRVGARTRTLRGLVRDTQRALNDVCDILNYDPDILVTVQDIGNQLARSTAIVVLGSTPSAKARLLHCLLGRQLLPDSPPRGCRWLRIQYGSTTQVHLTLGNSEFELVEELECNKRPWETLPVEDLLRRDNADASTILEVEINNQFLRDGLKIIIPPDISVEPGLADHLTLKKLHHELYTKRESILRSINPVYLYGIDRMGKNIFSDNIMNSLVVSKSEEDFWDSFNLYCMSKSEREREKTEIVIDREDREWNSTREPCVFSGENCLDLHQIKEINPNAQVMFVLFSDSAETCGAGRGGGAARLLLDVEATESTEGSVCCDELPESDQGLVQIRNNNGSPTSKAQDDRRLHEAQIAFLNELLDQWELMSSRPQKHQVKSQWMILNELAVHRGGEGGAGGARGAGSRTALLGAVVRFATDTALADLLQRATRLGEIHVKLLQQFILASYDMARELQVVPKKIQYVARQEQQLYETIHEKFTEGDKKHELLRIMQDVLQEMKHEINNMDWSVDDLPCHQDHRFTVSSSTFYSARPSPEHPRDWSRSPDPSDGEEAVSYDTYNFDDYEIIQQGLDTFGDSLPMRVRPEEDASKFNNIKIENEYESCSVSSARSGWAVATGSDVTTCTNNTNVSIKQASLDVQQTVLSKLSRKISLKLVKFVDCLKNTYFGTLQRCLESLESSCRQELGGLPASEAMRQLLSVAWQVDLQPCASFSVLRTLIESLRRLLHKLKIVSGEDDDACCVLSPVWRRHVAMHAAHSLNPHRLARLISTQILEKLSTAHERYQSALASLEAALTGRLHHTEDVKLAIRKKHAPSFARLCLESTSLCDMLMHGVPELGREIGRGQYGVVYAVRGSWGGHSPVAVKSVLPTDERHYHELAMEFFYTRSIPAHPRIVRLYGSIVQRQSSGPSVLLVSERKCRDLHAAVRAKLPFSTRMRISCDIVDGIRYLHSLGLVHRDIKTKNVLLDGADRAALSDLGFCTAGALMSGSVVGTPVHMAPELLAGDYHASVDVYAFGILFWYVCAGDIKLPSAFETFQNKEQLWSKVKRGLRPERLPQFSDECWEIMESCWASEPSQRALLGDVQNKLERILEQALKDEKSPGYLAPDEPDLNDD

Summary

Pfam
PF00069   Pkinase
Interpro
IPR000719   Prot_kinase_dom        + More
IPR017441   Protein_kinase_ATP_BS       
IPR011009   Kinase-like_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
SUPFAM
SSF56112   SSF56112       
PDB
5AMN     E-value=1.84274e-18,     Score=232

Ontologies

Topology

Length:
1120
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.2579
Exp number, first 60 AAs:
0.00097
Total prob of N-in:
0.00017
outside
1  -  1120
 
 

Population Genetic Test Statistics

Pi
25.193447
Theta
29.349663
Tajima's D
-0.780946
CLR
0.001618
CSRT
0.178691065446728
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号