SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16541
Pre Gene Modal
BGIBMGA004548
Annotation
PREDICTED:_uncharacterized_protein_LOC101735730_isoform_X4_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.786
 

Sequence

CDS
ATGGCCGCACACCAAGATTCTATCCATGAGAGACTTCAACCGGCACCAGAAGAACCGCTATATCTCCGCCATGGAACGCCAACTTGGCCCGAAGCTAATGACAACCAAGAAGATCACAGCGCCGACTTATCTCCGTACTACAACATGCCCAAACGGAACAAAAGAAAGAACTTCAAGCCTCGATGCGCTCCTAACACCTCAGCATTTTCTGATGACTCGAACGAAGGCAACTGCGAGGACACGAGGAGTTCAATCAACGGAAATGAGAGAACTACTCCTGAACACATAGAAGATGACAAAGAAGACGGAGGCTACGCTAAAATCGGCGTGAAGAACTTTAATCTATTGAAAGGAGGTGCTGTAGATCTCAGTAGAAGATTAAGCACAGATTCAAATGAGAATATAGAATCGAATTACCAAGACAGGTTAACAGAAAACAAAAAGGTAGATTCTTTTCAGAGAACCTACATCCACAGCCTTCAGATGACCCAAGCTAGTGAAAACGATAGGACCGTGTTAAACTTTAGTAATTTACAAAACAAAACATTTTGTGCCAAAAATCCTTTTGCTATATCACAACTAATCAAAACAAACTCTCCGCCGAGGAGAAGGGACTCTGATTCCGATGAAGACAAAGGGCAGGATATAAACGCTAATGAAAGGTTAGAAAATCAAGAGTCGATAGAAACCGATGCCCAATCTAATGGAGACACGAACAATGCTACAAACAGAATCTTGAGAGATTACGCTATGAATACAATGAAGGAATTACTCGGGATTTACGGTTTATCTTCTAATGAAGTCGCTGAGGCCATAAGTGGGCAGATAAGGGCTTTAGAAGCACTTCAAGGTAAACCTTTCACCCAACTACCGCTTAGTTTGAAGAGGCGCCACGACTCAACACTGGAAGACGGCACCGAAAGAAGTATCAGAAGATCCTCGTCGGCTACCGAGGATGAGGACTCTACGAATATTACACCACCGAAGACACCAGATAACGAATTGCAAGCACAAAGACAAAGAGCTTTACAAATAATCAACCAACAATCAATGAGGCTGTTTAATAGATCTCAGGCCCAGGAGGAAGACGGCAGCGGATCTGATGACGGAGACCAGACCCTCGATTTGAGTGTGTCCAGGGACACAGATGGACAAGAACAGTCCACAACGTCGAGCGCGGGAAACAGTGTATCAGAGTTCGAGCAGCAAAACATGCTGATGAGGAAGAATCTCGAAGATTTGGCCAATCTGCAGATGCAGGGCTACTTCCAGAAGCAATCGTTGGACGCTGATGATTCGCAAGAAAGAAAACTTCAAGCCAGTGGTGAGTGTCAATAA
Protein
MAAHQDSIHERLQPAPEEPLYLRHGTPTWPEANDNQEDHSADLSPYYNMPKRNKRKNFKPRCAPNTSAFSDDSNEGNCEDTRSSINGNERTTPEHIEDDKEDGGYAKIGVKNFNLLKGGAVDLSRRLSTDSNENIESNYQDRLTENKKVDSFQRTYIHSLQMTQASENDRTVLNFSNLQNKTFCAKNPFAISQLIKTNSPPRRRDSDSDEDKGQDINANERLENQESIETDAQSNGDTNNATNRILRDYAMNTMKELLGIYGLSSNEVAEAISGQIRALEALQGKPFTQLPLSLKRRHDSTLEDGTERSIRRSSSATEDEDSTNITPPKTPDNELQAQRQRALQIINQQSMRLFNRSQAQEEDGSGSDDGDQTLDLSVSRDTDGQEQSTTSSAGNSVSEFEQQNMLMRKNLEDLANLQMQGYFQKQSLDADDSQERKLQASGECQ

Summary

Interpro
IPR017956   AT_hook_DNA-bd_motif        + More
IPR013087   Znf_C2H2_type       
IPR040373   CASZ1       

Ontologies

Topology

Length:
445
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00214
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00618
outside
1  -  445
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号