SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16539
Pre Gene Modal
BGIBMGA005643
Annotation
PREDICTED:_WAS_protein_family_homolog_1-like_[Amyelois_transitella]
Full name
WASH complex subunit 1       + More
WAS protein family homolog 2      
Alternative Name
WAS protein family homolog 1
CXYorf1-like protein on chromosome 2
Protein FAM39B
CXYorf1-like protein on chromosome 9
Protein FAM39E
Location in the cell
Cytoplasmic   Reliability : 1.785 Nuclear   Reliability : 1.966
 

Sequence

CDS
ATGGAAGGTATTTACAAAATTAATCTTGTGCCAAGCGACTTGAGCACTGAAGAAGCCATCCTTCAGATTGCTGACACTATTGATAATCTCAATGGGATAGTGGAAGACGTGTTCTCTCGCTTAACGCGGCGAATCAAGCAGAATGTAGATAAAACCGCAAAATTGAATGAACGCATCGAAAACTCTAGGCTTAAAGTTGAAAAACTGACTGGAATGCAGAGAGCCATCAAAGTGTTCTCGAGTGCAAAGTACCCGTCGTCAATAACGCACGAGCATTATCGATCCGTCTTTGATTTGGAAGGCTATCAACATGTGCCTAAAAATGTTAAACTGAGTGCTAAAACTCGGGGGCCATCTGATGATAAAAGAATACAGGAGAAGCTACACTTCTATCATGTTAAAGTTGCGGAACCTAATTCACTCAAGCCCGATGAAGATTTTAGTTTGAACGCTGTTATTGATAACCTGGAAACCATCGGTGAACTTTTAGTATTTAACACCGATGAAAGCCCTTACTTCGGTGTTACCTCTAAAACACCAACCTACAAACCGGTCATCAAGAAATCGAATATTGAAAATAAGAGTCTAATAGAAGCGGCACCTTCGTCTATAATGAAGAAAGACGTCTTGAAGCGCGAAGTAGACGAATACATGTACGCACCTGGGATGGGAATGGTACCCGAAATGGAGATGCCGTTGGATTTACCGCATCTTCCAGGAATCGCTGAGGACATACAATATACTATCGCGACTGAAGGGTCTATAGCCCCGTCTGTCGTGACGTCACCGGTCACGCCGATCATCGCCATTCCTGAGGTGGAATTACCAGAGTTGCCCGATCTAAAGGAACTACCTGACGTGAAACCAGAGCCCGTGGCTATACCAGATATACCGGACGCTCCTCCGTCACCGGTTCCTGTTAGTGTGCAAGCGTTGCCACCACCGCCGCCCCCGCCACCGCCTCCGCCCCCGCCGCCGCCTATGAAGGAAGTAGAGCTCACACCATCAAAACGGTAA
Protein
MEGIYKINLVPSDLSTEEAILQIADTIDNLNGIVEDVFSRLTRRIKQNVDKTAKLNERIENSRLKVEKLTGMQRAIKVFSSAKYPSSITHEHYRSVFDLEGYQHVPKNVKLSAKTRGPSDDKRIQEKLHFYHVKVAEPNSLKPDEDFSLNAVIDNLETIGELLVFNTDESPYFGVTSKTPTYKPVIKKSNIENKSLIEAAPSSIMKKDVLKREVDEYMYAPGMGMVPEMEMPLDLPHLPGIAEDIQYTIATEGSIAPSVVTSPVTPIIAIPEVELPELPDLKELPDVKPEPVAIPDIPDAPPSPVPVSVQALPPPPPPPPPPPPPPPMKEVELTPSKR

Summary

Description
Acts as a nucleation-promoting factor at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting. Its assembly in the WASH core complex seems to inhibit its NPF activity and is required for its membrane targeting.
Acts as a nucleation-promoting factor (NPF) at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting. Its assembly in the WASH core complex seems to inhibit its NPF activity and via WASHC2 is required for its membrane targeting. Involved in endocytic trafficking of EGF. Involved in transferrin receptor recycling. Regulates the trafficking of endosomal alpha5beta1 integrin to the plasma membrane and involved in invasive cell migration. In T-cells involved in endosome-to-membrane recycling of receptors including T-cell receptor (TCR), CD28 and ITGAL; proposed to be implicated in T-cell proliferation and effector function. In dendritic cells involved in endosome-to-membrane recycling of major histocompatibility complex (MHC) class II probably involving retromer and subsequently allowing antigen sampling, loading and presentation during T-cell activation. Involved in negative regulation of autophagy independently from its role in endosomal sorting by inhibiting BECN1 ubiquitination to inactivate PIK3C3/Vps34 activity (By similarity).
Acts as a nucleation-promoting factor at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting. Involved in endocytic trafficking of EGF. Its assembly in the WASH core complex seems to inhibit its NPF activity and via WASHC2 is required for its membrane targeting. Involved in transferrin receptor recycling. Regulates the trafficking of endosomal alpha5beta1 integrin to the plasma membrane and involved in invasive cell migration. In T-cells involved in endosome-to-membrane recycling of receptors including T-cell receptor (TCR), CD28 and ITGAL; proposed to be implicated in T-cell proliferation and effector function. In dendritic cells involved in endosome-to-membrane recycling of major histocompatibility complex (MHC) class II probably involving retromer and subsequently allowing antigen sampling, loading and presentation during T-cell activation. Involved in Arp2/3 complex-dependent actin assembly driving Salmonella typhimurium invasion independent of ruffling. Involved in the exocytosis of MMP14 leading to matrix remodeling during invasive migration and implicating late endosome-to-plasma membrane tubular connections and cooperation with the exocyst complex. Involved in negative regulation of autophagy independently from its role in endosomal sorting by inhibiting BECN1 ubiquitination to inactivate PIK3C3/Vps34 activity (By similarity).
Acts as a nucleation-promoting factor (NPF) at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting (PubMed:19922874, PubMed:19922875, PubMed:20498093, PubMed:23452853). Its assembly in the WASH core complex seems to inhibit its NPF activity and via WASHC2 is required for its membrane targeting (PubMed:20498093). Involved in endocytic trafficking of EGF (By similarity). Involved in transferrin receptor recycling. Regulates the trafficking of endosomal alpha5beta1 integrin to the plasma membrane and involved in invasive cell migration (PubMed:22114305). In T-cells involved in endosome-to-membrane recycling of receptors including T-cell receptor (TCR), CD28 and ITGAL; proposed to be implicated in T cell proliferation and effector function. In dendritic cells involved in endosome-to-membrane recycling of major histocompatibility complex (MHC) class II probably involving retromer and subsequently allowing antigen sampling, loading and presentation during T-cell activation (By similarity). Involved in Arp2/3 complex-dependent actin assembly driving Salmonella typhimurium invasion independent of ruffling. Involved in the exocytosis of MMP14 leading to matrix remodeling during invasive migration and implicating late endosome-to-plasma membrane tubular connections and cooperation with the exocyst complex (PubMed:24344185). Involved in negative regulation of autophagy independently from its role in endosomal sorting by inhibiting BECN1 ubiquitination to inactivate PIK3C3/Vps34 activity (By similarity).
Subunit
Component of the WASH complex.
Component of the WASH core complex also described as WASH regulatory complex SHRC composed of WASHC1, WASHC2, WASHC3, WASHC4 and WASHC5. The WASH core complex associates with the F-actin-capping protein dimer (formed by CAPZA1, CAPZA2 or CAPZA3 and CAPZB); the assembly has been initially described as WASH complex (PubMed:20498093). Interacts (via WHD1 region) with WASHC2; the interaction is direct. Interacts with alpha-tubulin. Interacts with BECN1; WASHC1 and AMBRA1 can competetively interact with BECN1. Interacts with BLOC1S2; may associate with the BLOC-1 complex. Interacts with tubulin gamma chain (TUBG1 or TUBG2) (By similarity). Interacts with TBC1D23 (By similarity).
Component of the WASH core complex also described as WASH regulatory complex (SHRC) composed of WASH (WASHC1, WASH2P or WASH3P), WASHC2 (WASHC2A or WASHC2C), WASHC3, WASHC4 and WASHC5. The WASH core complex associates with the F-actin-capping protein dimer (formed by CAPZA1, CAPZA2 or CAPZA3 and CAPZB) in a transient or substoichiometric manner which was initially described as WASH complex. Interacts (via WHD1 region) with WASHC2C; the interaction is direct. Interacts with alpha-tubulin. Interacts with BECN1; WASHC1 and AMBRA1 can competetively interact with BECN1. Interacts with BLOC1S2; may associate with the BLOC-1 complex. Interacts with tubulin gamma chain (TUBG1 or TUBG2). Interacts with EXOC1, EXOC4, EXOC8; in MMP14-positive endosomes in breast tumor cells; indicative for an association with the exocyst complex (By similarity).
Component of the WASH core complex also described as WASH regulatory complex (SHRC) composed of WASH (WASHC1, WASH2P or WASH3P), WASHC2 (WASHC2A or WASHC2C), WASHC3, WASHC4 and WASHC5. The WASH core complex associates via WASHC2 with the F-actin-capping protein dimer (formed by CAPZA1, CAPZA2 or CAPZA3 and CAPZB) in a transient or substoichiometric manner which was initially described as WASH complex (PubMed:19922875, PubMed:20498093). Interacts (via WHD1 region) with WASHC2C; the interaction is direct (PubMed:19922874). Interacts with VPS35; mediates the association with the retromer CSC complex. Interacts with FKBP15. Interacts with alpha-tubulin. Interacts with BECN1; this interaction can be competed out by AMBRA1 binding. Interacts with BLOC1S2; may associate with the BLOC-1 complex. Interacts with tubulin gamma chain (TUBG1 or TUBG2) (By similarity). Interacts with EXOC1, EXOC4, EXOC8; in MMP14-positive endosomes in breast tumor cells; indicative for an association with the exocyst complex (PubMed:24344185). Interacts with TBC1D23 (PubMed:29084197).
Miscellaneous
WASH genes duplicated to multiple chromosomal ends during primate evolution, with highest copy number reached in humans, whose WASH repertoires probably vary extensively among individuals (PubMed:18159949). It is therefore difficult to determine which gene is functional or not. The telomeric region of chromosome 9p is paralogous to the pericentromeric regions of chromosome 9 as well as to 2q. Paralogous regions contain 7 transcriptional units. Duplicated WASH genes are also present in the Xq/Yq pseudoautosomal region, as well as on chromosome 1 and 15. The chromosome 16 copy seems to be a pseudogene.
Similarity
Belongs to the WASH1 family.
Keywords
Actin-binding   Complete proteome   Endosome   Membrane   Protein transport   Reference proteome   Transport   Cytoplasm   Cytoplasmic vesicle   Cytoskeleton   Isopeptide bond   Ubl conjugation  
Feature
chain  WASH complex subunit 1
EMBL
BABH01020206    GDQN01010433    JAT80621.1    NWSH01001832    PCG69961.1    ODYU01006205    + More
SOQ47848.1    FP102340    CBH09279.1    KQ461155    KPJ08302.1    KC469893    AGC92689.2    KQ459232    KPJ02631.1    AGBW02013517    OWR43294.1    JTDY01001858    KOB72702.1    KK852908    KDR13973.1    NEVH01015305    PNF27145.1    PNF27144.1    KQ432990    KOF62581.1    GEZM01093099    JAV56345.1    AAGJ04120810    GG666462    EEN68686.1    CR855419    BC123023    JH816276    EKC30659.1    DS469580    EDO41211.1    JH431845    BC085201    CM001288    EHH55871.1    JU332380    JV045823    CM001265    AFE76135.1    AFI35894.1    EHH22444.1    AHZZ02001504    ABGA01235378    AQIB01143913    AQIB01143914    ADFV01077923    ADFV01077924    MRZV01000247    PIK54489.1    KI210047    ERL96144.1    EAAA01002669    AAKN02038674    GABF01005071    JAA17074.1    AAGW02051487    BC153261    KI207928    ERL95758.1    APGK01045630    APGK01045631    KB741037    ENN74672.1    AGTP01074412    JH168787    EHB05253.1    CYRY02034003    VCX10606.1    JARO02006858    KPP64679.1    GEBF01004127    JAN99505.1    KB320463    ELW71462.1    JP021039    AES09637.1    AEFK01193797    AEFK01193798    AEFK01193799    AEYP01081943    MWRG01000475    PRD36026.1    AANG04001873    AL078621    AY341936    AMQN01005391    KB295903    ELU12510.1    AEMK02000037    AK289708    AL928970    AJWK01019202    AAEX03015316    ACTA01137259    KV930729    PIO31721.1    FR904704    CDQ70209.1   
Pfam
PF11945   WASH_WAHD        + More
PF00080   Sod_Cu
PF00403   HMA
Interpro
IPR021854   WASH1_WAHD        + More
IPR028290   WASH1       
IPR003124   WH2_dom       
IPR006121   HMA_dom       
IPR036423   SOD-like_Cu/Zn_dom_sf       
IPR036163   HMA_dom_sf       
IPR001424   SOD_Cu_Zn_dom       
IPR017969   Heavy-metal-associated_CS       
SUPFAM
SSF55008   SSF55008        + More
SSF49329   SSF49329       
Gene 3D

Ontologies

Topology

Subcellular location
Early endosome membrane  
Recycling endosome membrane  
Late endosome   Localization to the endosome membrane is mediated via its interaction with WASHC2.   With evidence from 1 publications.
Cytoplasmic vesicle   Localization to the endosome membrane is mediated via its interaction with WASHC2.   With evidence from 1 publications.
Autophagosome   Localization to the endosome membrane is mediated via its interaction with WASHC2.   With evidence from 1 publications.
Cytoplasm   Localization to the endosome membrane is mediated via its interaction with WASHC2.   With evidence from 1 publications.
Cytoskeleton   Localization to the endosome membrane is mediated via its interaction with WASHC2.   With evidence from 1 publications.
Microtubule organizing center   Localization to the endosome membrane is mediated via its interaction with WASHC2.   With evidence from 1 publications.
Centrosome   Localization to the endosome membrane is mediated via its interaction with WASHC2.   With evidence from 1 publications.
Centriole   Localization to the endosome membrane is mediated via its interaction with WASHC2.   With evidence from 1 publications.
Length:
338
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00051
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01543
outside
1  -  338
 
 

Population Genetic Test Statistics

Pi
6.590049
Theta
11.261515
Tajima's D
-0.523821
CLR
0
CSRT
0.241637918104095
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号