Pre Gene Modal
BGIBMGA005643
Annotation
PREDICTED:_WAS_protein_family_homolog_1-like_[Amyelois_transitella]
Full name
WASH complex subunit 1
+ More
WAS protein family homolog 2
Alternative Name
WAS protein family homolog 1
CXYorf1-like protein on chromosome 2
Protein FAM39B
CXYorf1-like protein on chromosome 9
Protein FAM39E
Location in the cell
Cytoplasmic Reliability : 1.785 Nuclear Reliability : 1.966
Sequence
CDS
ATGGAAGGTATTTACAAAATTAATCTTGTGCCAAGCGACTTGAGCACTGAAGAAGCCATCCTTCAGATTGCTGACACTATTGATAATCTCAATGGGATAGTGGAAGACGTGTTCTCTCGCTTAACGCGGCGAATCAAGCAGAATGTAGATAAAACCGCAAAATTGAATGAACGCATCGAAAACTCTAGGCTTAAAGTTGAAAAACTGACTGGAATGCAGAGAGCCATCAAAGTGTTCTCGAGTGCAAAGTACCCGTCGTCAATAACGCACGAGCATTATCGATCCGTCTTTGATTTGGAAGGCTATCAACATGTGCCTAAAAATGTTAAACTGAGTGCTAAAACTCGGGGGCCATCTGATGATAAAAGAATACAGGAGAAGCTACACTTCTATCATGTTAAAGTTGCGGAACCTAATTCACTCAAGCCCGATGAAGATTTTAGTTTGAACGCTGTTATTGATAACCTGGAAACCATCGGTGAACTTTTAGTATTTAACACCGATGAAAGCCCTTACTTCGGTGTTACCTCTAAAACACCAACCTACAAACCGGTCATCAAGAAATCGAATATTGAAAATAAGAGTCTAATAGAAGCGGCACCTTCGTCTATAATGAAGAAAGACGTCTTGAAGCGCGAAGTAGACGAATACATGTACGCACCTGGGATGGGAATGGTACCCGAAATGGAGATGCCGTTGGATTTACCGCATCTTCCAGGAATCGCTGAGGACATACAATATACTATCGCGACTGAAGGGTCTATAGCCCCGTCTGTCGTGACGTCACCGGTCACGCCGATCATCGCCATTCCTGAGGTGGAATTACCAGAGTTGCCCGATCTAAAGGAACTACCTGACGTGAAACCAGAGCCCGTGGCTATACCAGATATACCGGACGCTCCTCCGTCACCGGTTCCTGTTAGTGTGCAAGCGTTGCCACCACCGCCGCCCCCGCCACCGCCTCCGCCCCCGCCGCCGCCTATGAAGGAAGTAGAGCTCACACCATCAAAACGGTAA
Protein
MEGIYKINLVPSDLSTEEAILQIADTIDNLNGIVEDVFSRLTRRIKQNVDKTAKLNERIENSRLKVEKLTGMQRAIKVFSSAKYPSSITHEHYRSVFDLEGYQHVPKNVKLSAKTRGPSDDKRIQEKLHFYHVKVAEPNSLKPDEDFSLNAVIDNLETIGELLVFNTDESPYFGVTSKTPTYKPVIKKSNIENKSLIEAAPSSIMKKDVLKREVDEYMYAPGMGMVPEMEMPLDLPHLPGIAEDIQYTIATEGSIAPSVVTSPVTPIIAIPEVELPELPDLKELPDVKPEPVAIPDIPDAPPSPVPVSVQALPPPPPPPPPPPPPPPMKEVELTPSKR
Summary
Description
Acts as a nucleation-promoting factor at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting. Its assembly in the WASH core complex seems to inhibit its NPF activity and is required for its membrane targeting.
Acts as a nucleation-promoting factor (NPF) at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting. Its assembly in the WASH core complex seems to inhibit its NPF activity and via WASHC2 is required for its membrane targeting. Involved in endocytic trafficking of EGF. Involved in transferrin receptor recycling. Regulates the trafficking of endosomal alpha5beta1 integrin to the plasma membrane and involved in invasive cell migration. In T-cells involved in endosome-to-membrane recycling of receptors including T-cell receptor (TCR), CD28 and ITGAL; proposed to be implicated in T-cell proliferation and effector function. In dendritic cells involved in endosome-to-membrane recycling of major histocompatibility complex (MHC) class II probably involving retromer and subsequently allowing antigen sampling, loading and presentation during T-cell activation. Involved in negative regulation of autophagy independently from its role in endosomal sorting by inhibiting BECN1 ubiquitination to inactivate PIK3C3/Vps34 activity (By similarity).
Acts as a nucleation-promoting factor at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting. Involved in endocytic trafficking of EGF. Its assembly in the WASH core complex seems to inhibit its NPF activity and via WASHC2 is required for its membrane targeting. Involved in transferrin receptor recycling. Regulates the trafficking of endosomal alpha5beta1 integrin to the plasma membrane and involved in invasive cell migration. In T-cells involved in endosome-to-membrane recycling of receptors including T-cell receptor (TCR), CD28 and ITGAL; proposed to be implicated in T-cell proliferation and effector function. In dendritic cells involved in endosome-to-membrane recycling of major histocompatibility complex (MHC) class II probably involving retromer and subsequently allowing antigen sampling, loading and presentation during T-cell activation. Involved in Arp2/3 complex-dependent actin assembly driving Salmonella typhimurium invasion independent of ruffling. Involved in the exocytosis of MMP14 leading to matrix remodeling during invasive migration and implicating late endosome-to-plasma membrane tubular connections and cooperation with the exocyst complex. Involved in negative regulation of autophagy independently from its role in endosomal sorting by inhibiting BECN1 ubiquitination to inactivate PIK3C3/Vps34 activity (By similarity).
Acts as a nucleation-promoting factor (NPF) at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting (PubMed:19922874, PubMed:19922875, PubMed:20498093, PubMed:23452853). Its assembly in the WASH core complex seems to inhibit its NPF activity and via WASHC2 is required for its membrane targeting (PubMed:20498093). Involved in endocytic trafficking of EGF (By similarity). Involved in transferrin receptor recycling. Regulates the trafficking of endosomal alpha5beta1 integrin to the plasma membrane and involved in invasive cell migration (PubMed:22114305). In T-cells involved in endosome-to-membrane recycling of receptors including T-cell receptor (TCR), CD28 and ITGAL; proposed to be implicated in T cell proliferation and effector function. In dendritic cells involved in endosome-to-membrane recycling of major histocompatibility complex (MHC) class II probably involving retromer and subsequently allowing antigen sampling, loading and presentation during T-cell activation (By similarity). Involved in Arp2/3 complex-dependent actin assembly driving Salmonella typhimurium invasion independent of ruffling. Involved in the exocytosis of MMP14 leading to matrix remodeling during invasive migration and implicating late endosome-to-plasma membrane tubular connections and cooperation with the exocyst complex (PubMed:24344185). Involved in negative regulation of autophagy independently from its role in endosomal sorting by inhibiting BECN1 ubiquitination to inactivate PIK3C3/Vps34 activity (By similarity).
Subunit
Component of the WASH complex.
Component of the WASH core complex also described as WASH regulatory complex SHRC composed of WASHC1, WASHC2, WASHC3, WASHC4 and WASHC5. The WASH core complex associates with the F-actin-capping protein dimer (formed by CAPZA1, CAPZA2 or CAPZA3 and CAPZB); the assembly has been initially described as WASH complex (PubMed:20498093). Interacts (via WHD1 region) with WASHC2; the interaction is direct. Interacts with alpha-tubulin. Interacts with BECN1; WASHC1 and AMBRA1 can competetively interact with BECN1. Interacts with BLOC1S2; may associate with the BLOC-1 complex. Interacts with tubulin gamma chain (TUBG1 or TUBG2) (By similarity). Interacts with TBC1D23 (By similarity).
Component of the WASH core complex also described as WASH regulatory complex (SHRC) composed of WASH (WASHC1, WASH2P or WASH3P), WASHC2 (WASHC2A or WASHC2C), WASHC3, WASHC4 and WASHC5. The WASH core complex associates with the F-actin-capping protein dimer (formed by CAPZA1, CAPZA2 or CAPZA3 and CAPZB) in a transient or substoichiometric manner which was initially described as WASH complex. Interacts (via WHD1 region) with WASHC2C; the interaction is direct. Interacts with alpha-tubulin. Interacts with BECN1; WASHC1 and AMBRA1 can competetively interact with BECN1. Interacts with BLOC1S2; may associate with the BLOC-1 complex. Interacts with tubulin gamma chain (TUBG1 or TUBG2). Interacts with EXOC1, EXOC4, EXOC8; in MMP14-positive endosomes in breast tumor cells; indicative for an association with the exocyst complex (By similarity).
Component of the WASH core complex also described as WASH regulatory complex (SHRC) composed of WASH (WASHC1, WASH2P or WASH3P), WASHC2 (WASHC2A or WASHC2C), WASHC3, WASHC4 and WASHC5. The WASH core complex associates via WASHC2 with the F-actin-capping protein dimer (formed by CAPZA1, CAPZA2 or CAPZA3 and CAPZB) in a transient or substoichiometric manner which was initially described as WASH complex (PubMed:19922875, PubMed:20498093). Interacts (via WHD1 region) with WASHC2C; the interaction is direct (PubMed:19922874). Interacts with VPS35; mediates the association with the retromer CSC complex. Interacts with FKBP15. Interacts with alpha-tubulin. Interacts with BECN1; this interaction can be competed out by AMBRA1 binding. Interacts with BLOC1S2; may associate with the BLOC-1 complex. Interacts with tubulin gamma chain (TUBG1 or TUBG2) (By similarity). Interacts with EXOC1, EXOC4, EXOC8; in MMP14-positive endosomes in breast tumor cells; indicative for an association with the exocyst complex (PubMed:24344185). Interacts with TBC1D23 (PubMed:29084197).
Miscellaneous
WASH genes duplicated to multiple chromosomal ends during primate evolution, with highest copy number reached in humans, whose WASH repertoires probably vary extensively among individuals (PubMed:18159949). It is therefore difficult to determine which gene is functional or not. The telomeric region of chromosome 9p is paralogous to the pericentromeric regions of chromosome 9 as well as to 2q. Paralogous regions contain 7 transcriptional units. Duplicated WASH genes are also present in the Xq/Yq pseudoautosomal region, as well as on chromosome 1 and 15. The chromosome 16 copy seems to be a pseudogene.
Similarity
Belongs to the WASH1 family.
Keywords
Actin-binding
Complete proteome
Endosome
Membrane
Protein transport
Reference proteome
Transport
Cytoplasm
Cytoplasmic vesicle
Cytoskeleton
Isopeptide bond
Ubl conjugation
Feature
chain WASH complex subunit 1
Ontologies
Topology
Subcellular location
Early endosome membrane
Recycling endosome membrane
Late endosome
Localization to the endosome membrane is mediated via its interaction with WASHC2. With evidence from 1 publications.
Cytoplasmic vesicle
Localization to the endosome membrane is mediated via its interaction with WASHC2. With evidence from 1 publications.
Autophagosome
Localization to the endosome membrane is mediated via its interaction with WASHC2. With evidence from 1 publications.
Cytoplasm
Localization to the endosome membrane is mediated via its interaction with WASHC2. With evidence from 1 publications.
Cytoskeleton
Localization to the endosome membrane is mediated via its interaction with WASHC2. With evidence from 1 publications.
Microtubule organizing center
Localization to the endosome membrane is mediated via its interaction with WASHC2. With evidence from 1 publications.
Centrosome
Localization to the endosome membrane is mediated via its interaction with WASHC2. With evidence from 1 publications.
Centriole
Localization to the endosome membrane is mediated via its interaction with WASHC2. With evidence from 1 publications.
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00051
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01543
Population Genetic Test Statistics
Multiple alignment of Orthologues
Gene Tree