SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16536
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 2.713
 

Sequence

CDS
ATGCCGATTGGGAAAGTTGAAAGTTTTGATATGGGATCTCAAAATTGGGACACATACATTCGTCGTGTAAAACAATTCATGGAACTCAACGACATTGAACAGAGACTTCACGTTGCAACGCTCGTGACCTTAGTTGGGTCTGAGTGCTATGACTTAATGTGTGACTTGTGTGCTCCGGACTTACCAGAAGAAAAGGATTTCGACATACTCGTAAAATTAGTCAAAGATCATCTAGAACCTGAAAGATCGGAAATAGCAGAACGTCATATCTTCAGGCAAAGAAAGCAGCAAAATAACGAAAGCATTCGTTCCTACCTACAAAGTTTGAAACATTTGGCTAAAACTTGCAATTTCGGCATCACATTAGAAATTAATCTACGCGATCAATTCGTATCAGGATTTTATAGTGAGGAGATGCGATCAAGGCTGTTTGCTGAAAAAGATATAGATTACAAGCGCGCTGTTGAGTTGGCATCAGCACTGGAAGCAGCGGATCGACATGCGATGGCGGCTGGGGGCATTGGGGGCAGCTCACAGGCTGCGTCCGAGAGCGAAGGCATGCATCGGGTCGGCGGAGCGCGCGCGGAGGCTCAATGCGCCTGCAGACGCTGCGGCAAGCTGGGCCATGCGGAGGGTCGGTGTCGGTACAAGCACTACACCTGTGACTCATGTGGCGAGAAGGGACACCTAAAATCAATGTGTCGGAACCGTAAAGGTAACCAAAAGATTGAAAAAAACCGAGGTCAGTACTATTTAAACCATAGTGACTGTGATTCTAGTGATAATAGTTTTTATAACTTAAAGGACCTGATCAGTAGCGAGGGTGAAGGACCATATTACGTGAAAATTTTTGTACAAAATGTTCCATGTAAATTTGAGATTGATACGGGTTGTAAAATTTCGGCCATATCTAAAGCTTTTTATGAAAAGCATTTTATGTGTATTCCTATACAAAGCGAAATCTTGAATTTTAGTTCATATACAGGCGATGTAATTGAGACTATCGGTTATATAATGGTAGACGTATCTTGTGGTCGTGAGTCCGCCAAATTAAAACTATATGTAATTAAAAACGGCGGCCCGCCACTGCTAGGCCGAATTTGGATTAAAATATTAAAATTAAGTTTTCTAAAATGTCATTCGATTTCTGAGACGACCTCGACGGTGGAGGCTTTACGAAACGAATTTCCAGAAGTGTTTGCTGGAGGTTTAGGAACATGTAAATCACGCATAAAATTACATCTAAAAGAAAAGACGCCAATATTTGTAAAAGCGCGGGCGCTGCCACTGGCGTTGCGCGAGCGCGTTGAGCGAGAACTTGATCGTTTACAAAGTGAGGGAGTTATTTACAAAGTAGATAGGTCTGATTACGGCACGCCTATCGTACCAGTCGTTAAGGCAAATGGCGATATTCGTATTTGCGGCGACTATAAAATCACAATAAACCCACGTCTGAAGGATTATCACTATCCTTTGCCGCACATTAAAGATTTGTTTGCCACTTTAGGTGGTGGTGAATATTACACAAAATTGGATTTATCTAATGCATTCCAGCAATGCCTCTTAGACGAAGAATCCCAGCCGATGACAGCGATCACGACACACATTGGTACTTTTGTCTATAAGCGCGTTCCGTTTGGAATTAAATGCATTCCGGAAAACTTTCAGAAGATTATGGAAGAGATTCTAAGTGGTCTGCCGTCAACCGTTATTTTTGCGGACGATATATGTGTAACCGGAAAAAACAGATTTGAACATTTATCAAATCTACGAGCAGTGTTGAGGAGACTCAAAGAAAACGGATTAAGAATTAATTATGACAAATGTAAATTCTTTCAAAGTTCTGTTACGTATTTAGGCTATAAAATAGACAAACAGGGCTTACACACTGACAAAAAGAAAGTTGATGCTATAGTGGCCGCCCCCGCACCTACGAATTTAACTCAATTGAGAAGTTTTATGGGTCTTGTTAATTTTTATTCGAACTTCGTTGTTAATATGAGTGATATTTTGAAACCTTTGTATAATTTGTTAAAAAAAAATGTAGAATGGTGTTGGACAGATAAATGTCATCAAGCATTTATACGAATTAAAAAAGTGTTAAGCAGCTCTCCGGTACTGGCACATTATAACCCAAATTCGCCATTAGTGCTGTCCGTTGACAGCAGCCAGTACGGACTGGGCGCCGTCCTCACTCAGAAGCACATCGACGGCACTGAGCGGCTCGTCAGCTGTGGCTCACGGACTCTCGCGCCAGCCGAACTTAACTATTCTCAGCTGGACAAAGAAGCTTTGGCTATAATGTTTGGGGTTACTAAACACCATCAGTATTTGTACGGGAGACGTTTTGTTTTACGAAGTGATCATAAGGCTTTGAGTTATATTCTTGGAAAGAATAAAGGTATACCTCTAACCGCCGCGAGTCGTCTGCAACGATTTGCTGTAAAGCTAGCTGCGTATGATTTTGAGATCGAATTTATTAGTTCTACAGATAATTGCCAGGCTGACGCGCTATCACGACTTCCACTGGATACTAATTTTAAGAATAATATTAAGGAATATAATTACCTAAACTTCGTTCAAGAAAGCTTTCCACTCAGTTTTAAAGAAATTAAAAAGGAAGTTGCGAAGGATCCTTTACTAAACAAAATTTACGGTTACGTCATGTTTGGCTGGCCCTCTGTCAGTAAAGAACAAGCAGAAAAACCCTATTTTAACAGAAGAGAATCCATACATATTGATCACGGTTGTCTTGTATGGGGTTACAGAATAATAATTCCAACTTCATTGCGAGAGACTGTGTTACAGGAGTTACATGAGGGACATCCGGGTATTGTTAAGATGAAACAATTAAGCCGGAACTACGTATGGTGGGAGACAGTCGATGCGGACATTGAACGTGTATGTGCTCAGTGCCAGGCCTGTCGATCTCAGCGCGCTGCACCACCATCGGTGCCGCTGCACTCGTGGCCATGGCCGGAAGAGCCGTGGGCGCGCCTTAATCTTGATTTCTTGGGACCGTTCAATAACAAATATTACTTAATTATAGTGGACGCTCATTCAAAATGGATCGAGGTGGAAAAATTGAGCTGTACATCAGCCACGGCTGTAATCGCATGTCTCAGACGATTGTTTGCTCGATTTGGCTTAGCAAAAAGGGTAGTTACTGATAACGGACCACCTTTCTCGTCGGTCGAATTTAGATCATATTTAAGTAAAAACGGTATAAAACATTTACCGGTGGCTCCGTATCATCCATCTAGCAATGGTGCAGCGGAAAACGCCGTAAAAACCATAAAAAGAGTGTTGAAAAAGGCTTTAATTGAAAAGGAAGACGACAATACCGCCTTGACAAAATTTCTCTTTATGTACAGAAATTCTGAGCATAGCACTACAGGGCGCGAACCAGCAGTTGCTTTGTTCGGACGTCGCCTGCGTGGAAGACTGGATCTGTTGCGTCCCAATACCAGCTCCATAGTACGAGAAGCACAGCTGGCAAGCGAAAGCTATAATGCAGGCACAGCCGGATATAGGGAGGCTGCAGAAGGAGACTCGGTCCTATTGCAAGATTTCACACAGGGAAAAAAGAAATGGACCCCAGGAACAATAAAAAACCGCTCAGGTCCGGTGACATACAGGGTAACAGCAGATGACGGGCGGGTACACAAACGTCACATCGACCAGATTTTAATAAGTAATAATAGTCGAAAATCACGTTATTCTTTGTCCAAATTAAACAATGATTTCGAGACAAAATCAGTAAATGATAGTGTGGGTGAAGCTCGGGAAAGTCCGGGTATGACCGGAGAAAAGGAGCTCAACTCCAGCTATGACACGGGACCGGAAAGTCCACAACCTGTGACTCCTAGTCACTCGCCGGCGCCGAATGTCTTGCAACCATCGCGTCAGCGCCGTAAAGCTGCTTTAACGTGTATTCAGAGAATTAAGGACCAAAATTACTAA
Protein
MPIGKVESFDMGSQNWDTYIRRVKQFMELNDIEQRLHVATLVTLVGSECYDLMCDLCAPDLPEEKDFDILVKLVKDHLEPERSEIAERHIFRQRKQQNNESIRSYLQSLKHLAKTCNFGITLEINLRDQFVSGFYSEEMRSRLFAEKDIDYKRAVELASALEAADRHAMAAGGIGGSSQAASESEGMHRVGGARAEAQCACRRCGKLGHAEGRCRYKHYTCDSCGEKGHLKSMCRNRKGNQKIEKNRGQYYLNHSDCDSSDNSFYNLKDLISSEGEGPYYVKIFVQNVPCKFEIDTGCKISAISKAFYEKHFMCIPIQSEILNFSSYTGDVIETIGYIMVDVSCGRESAKLKLYVIKNGGPPLLGRIWIKILKLSFLKCHSISETTSTVEALRNEFPEVFAGGLGTCKSRIKLHLKEKTPIFVKARALPLALRERVERELDRLQSEGVIYKVDRSDYGTPIVPVVKANGDIRICGDYKITINPRLKDYHYPLPHIKDLFATLGGGEYYTKLDLSNAFQQCLLDEESQPMTAITTHIGTFVYKRVPFGIKCIPENFQKIMEEILSGLPSTVIFADDICVTGKNRFEHLSNLRAVLRRLKENGLRINYDKCKFFQSSVTYLGYKIDKQGLHTDKKKVDAIVAAPAPTNLTQLRSFMGLVNFYSNFVVNMSDILKPLYNLLKKNVEWCWTDKCHQAFIRIKKVLSSSPVLAHYNPNSPLVLSVDSSQYGLGAVLTQKHIDGTERLVSCGSRTLAPAELNYSQLDKEALAIMFGVTKHHQYLYGRRFVLRSDHKALSYILGKNKGIPLTAASRLQRFAVKLAAYDFEIEFISSTDNCQADALSRLPLDTNFKNNIKEYNYLNFVQESFPLSFKEIKKEVAKDPLLNKIYGYVMFGWPSVSKEQAEKPYFNRRESIHIDHGCLVWGYRIIIPTSLRETVLQELHEGHPGIVKMKQLSRNYVWWETVDADIERVCAQCQACRSQRAAPPSVPLHSWPWPEEPWARLNLDFLGPFNNKYYLIIVDAHSKWIEVEKLSCTSATAVIACLRRLFARFGLAKRVVTDNGPPFSSVEFRSYLSKNGIKHLPVAPYHPSSNGAAENAVKTIKRVLKKALIEKEDDNTALTKFLFMYRNSEHSTTGREPAVALFGRRLRGRLDLLRPNTSSIVREAQLASESYNAGTAGYREAAEGDSVLLQDFTQGKKKWTPGTIKNRSGPVTYRVTADDGRVHKRHIDQILISNNSRKSRYSLSKLNNDFETKSVNDSVGEARESPGMTGEKELNSSYDTGPESPQPVTPSHSPAPNVLQPSRQRRKAALTCIQRIKDQNY

Summary

EMBL
GEDC01007675    GEDC01003661    JAS29623.1    JAS33637.1    GEDC01023506    GEDC01023205    + More
JAS13792.1    JAS14093.1    GEFM01006397    JAP69399.1    RSAL01000130    RVE46453.1    HADX01010638    SBP32870.1    EF199621    ABM90392.1    EF199622    ABM90393.1    NIVC01001652    PAA65446.1    GGMR01020219    MBY32838.1    ABLF02016687    ABLF02016690    HADW01008367    SBP09767.1    NIVC01001377    PAA68677.1    GEZM01085308    JAV60010.1    GEZM01050895    JAV75318.1    NIVC01000860    PAA75827.1    GECU01037588    JAS70118.1    NIVC01001308    PAA69606.1    NIVC01000264    PAA86792.1    GEZM01014356    JAV92133.1    GEZM01092768    GEZM01092767    JAV56467.1    AB126055    BAD86655.1    GCES01009650    JAR76673.1    GEZM01009753    JAV94337.1    RQTK01000185    RUS85038.1    JYDO01000377    KRZ65389.1    GGMR01010825    MBY23444.1    JYDL01000080    KRX17894.1    GDHC01002706    JAQ15923.1    GEZM01001427    JAV97782.1    NIVC01000183    PAA88548.1    KL363295    KFD48373.1    NIVC01001575    PAA66240.1    ABLF02006499    ABLF02041879    GGLE01005288    MBY09414.1    KL363215    KFD53596.1    GCES01151725    JAQ34597.1    GCES01042893    JAR43430.1    ABLF02065955    JYDJ01000151    KRX42156.1    JYDH01000010    KRY40903.1    GEZM01050896    JAV75317.1    AAZX01023237    GEZM01030100    JAV85808.1    GGMR01017626    MBY30245.1    HAAD01006009    CDG72241.1    JYDW01000004    KRZ62956.1    GEZM01036245    JAV82862.1    JYDN01000036    KRX62850.1    JYDP01000327    KRZ01162.1    JYDO01000093    KRZ71620.1    NIRI01001153    RJW67559.1    JYDN01000181    KRX54093.1    HAEH01013823    SBR98409.1    JYDQ01000346    KRY08270.1    GEZM01042258    JAV80005.1    KL363391    KFD46136.1    JYDP01000057    KRZ10689.1    JYDQ01000124    KRY14116.1    GEZM01043158    JAV79264.1    JYDL01000058    KRX19511.1    JYDW01000348    KRZ48953.1    JYDO01000236    KRZ66548.1    KL363192    KFD56650.1    GFXV01004590    MBW16395.1    KL363314    KFD47775.1    GBHO01027669    GBHO01027668    JAG15935.1    JAG15936.1    GEGO01002490    JAR92914.1    GEGO01004367    JAR91037.1    MRZV01000143    PIK57404.1    GEZM01096183    JAV55075.1    GEZM01096184    JAV55073.1    NIVC01001899    PAA62793.1    ABLF02011319    ABLF02014651    ABLF02041920    NIVC01003024    PAA53787.1    KL363264    KFD49780.1    GEDV01003323    JAP85234.1    JYDJ01000764    KRX33566.1    GEHC01000992    JAV46653.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF00098   zf-CCHC
PF17917   RT_RNaseH
PF00077   RVP
PF00378   ECH_1
PF03732   Retrotrans_gag
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR034128   K02A2.6-like       
IPR001969   Aspartic_peptidase_AS       
IPR018061   Retropepsins       
IPR001753   Enoyl-CoA_hydra/iso       
IPR029045   ClpP/crotonase-like_dom_sf       
IPR005162   Retrotrans_gag_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF52096   SSF52096       
Gene 3D
PDB
4OL8     E-value=5.3887e-53,     Score=530

Ontologies

Topology

Length:
1320
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.000800000000000001
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00002
outside
1  -  1320
 
 

Population Genetic Test Statistics

Pi
15.959026
Theta
18.808697
Tajima's D
-0.949986
CLR
0
CSRT
0.147742612869357
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号