SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16534
Pre Gene Modal
BGIBMGA005562
Annotation
PREDICTED:_uncharacterized_protein_KIAA0195?_partial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.673
 

Sequence

CDS
ATGTGTCACCGAAATATATTCAAAATTTATTGCAGTGAAGACTTAGTTCCGGTGACAAATCGCCGTTGTCTCTGCGAGCTGGCCAAACAAATAGGATTCACAGATTCCGTCGCTGACGCCTACAGCGTGCAGCACTGTTTGTCAATATTCAGACATTTGCGCGCGGACACCATCCGGCGCGAGACGCGTTTCGTGCGCTCACTGCAACTGAGCACTCGGGTCAAGGTTCCCCTGCCGCATATGCTCGCCGTTCTAGTCAAGGACCACGCTAATCAATTGCAAATGCTCACTCAGGGTACCGCAGATATAGTGTTAGACTCGTGCGTAGATTACTGGAACGGGCGGGACTTAACACCGATATCTGCTTCCGACCGAAAGAAGATCATAGATTTTTACCAAAGAAACTCACTGACGGCCTATTGTACCGCTTTCGCTTACAAGCCGGTGACGCGCGGCGTGTCGTCGCCCGTGGCGGACATGTACCTGGAGGTGCCGGCGGAGGGGCGCGGGGGGCTGACGCCGCGCACGCAGCACTGGCCGGACGCGCCCGCACTGCACTTTCACTCAACTGATTCCCTACTGTTCAATGAAGTGACCGACGACGATGTTGTTGACGCCGATGGATATTTCGATCTGCAATGCAATCAAGTGTTCATAGGCATGGTGACGATGCAGTACCAGGCGCAGAGCGACATGGTGGAGCTGATAGAGCGGCTAGAGCGGGCCTGCATACGCTTCGTCCACTTCAGCAAGGAGAACGAGCTCCGGTCGAGGGTGTTCAGCGAAAAGATGGGCTTGGAGTCCGGCTGGAACTGTCACATATCGCTCATGAGCGACACCGAAGCCAGCAAAAGCGCATCGCCGCTGTCCTCGCAGAATATCGCGCAGCCAAAGGAACTTAACAACGGGAGGCGGCCCTCTAGGGGCTTCGAAACTTTTGACGCTCTCGGCTTTTGTCATAGCAATAGTATGGCAACATCGAAAGCGTTGTCTATGTCGGCGCCGGGAGCGATCAATCTAGATCACACTACCGTCAAATTCGACAACGAGGTCAAGAAGGCGAGGCACTCCATCACAACTGGAATCAAGATGCAGCGTGGCAGCATAGCGACGACGCATCCGTCGGCGGACTCTGCGCTGGACTCGCGCGAGGAGCCGGAGTCCCCGGTGGACGCGTGCCGCTCGCTGTCCTGCCTCACCGACTCCACCGACCACTCGGCGCAGCTCAACTTCGACATGAGCAATAGGGCTAAGTTGCCCCGAGGCATCGAGAACATCCGACCCCACATCGAGCAAGTGGACAACGTTCCGCTCCTCGTCTCGCTGTTCACGGACTGCACCGCGCGCTCCGTCCAGCTCATGATACAGATCATGCAGGATTACAGCGAGGTGGTTTGCGTGATGGGCTCCGCGGCCAACTGTCTCAACATGGAAATCTTCATGCAGGCCGACGCTAGCATCGCGGTTGAGCCTCTATATCCGGTACTGTGCCAAAAGATGCAACCGTACTTGATTCCCGACTCCTGCATCGGTCCCATCGACCTAGCTAGAGCACTCAATTCGGTCCCCTGTTCTTTGTCGATGACGCGGGAATCGGATCTGTCACTGTTCACATTAATAACGACGTCGCGTCACTTCATGACGTGCCTGTGGAACTGCACCCAGTTCTGGATATGTAGCGTTTGTTTCATAGCCCTGTTACAGGTTAGTGTGTGTTTGTACTTCTAG
Protein
MCHRNIFKIYCSEDLVPVTNRRCLCELAKQIGFTDSVADAYSVQHCLSIFRHLRADTIRRETRFVRSLQLSTRVKVPLPHMLAVLVKDHANQLQMLTQGTADIVLDSCVDYWNGRDLTPISASDRKKIIDFYQRNSLTAYCTAFAYKPVTRGVSSPVADMYLEVPAEGRGGLTPRTQHWPDAPALHFHSTDSLLFNEVTDDDVVDADGYFDLQCNQVFIGMVTMQYQAQSDMVELIERLERACIRFVHFSKENELRSRVFSEKMGLESGWNCHISLMSDTEASKSASPLSSQNIAQPKELNNGRRPSRGFETFDALGFCHSNSMATSKALSMSAPGAINLDHTTVKFDNEVKKARHSITTGIKMQRGSIATTHPSADSALDSREEPESPVDACRSLSCLTDSTDHSAQLNFDMSNRAKLPRGIENIRPHIEQVDNVPLLVSLFTDCTARSVQLMIQIMQDYSEVVCVMGSAANCLNMEIFMQADASIAVEPLYPVLCQKMQPYLIPDSCIGPIDLARALNSVPCSLSMTRESDLSLFTLITTSRHFMTCLWNCTQFWICSVCFIALLQVSVCLYF

Summary

EMBL
BABH01020203    BABH01020204    BABH01020205    BABH01020206    RSAL01000090    RVE48102.1    + More
NWSH01001832    PCG69963.1    KQ459232    KPJ02629.1    KQ461155    KPJ08304.1    KC469893    AGC92690.2    FP102340    CBH09281.1    AGBW02013517    OWR43291.1    QOIP01000007    RLU20670.1    KQ977171    KYN05181.1    GL445515    EFN89491.1    GL888167    EGI66276.1    KK107238    EZA54621.1    KQ981561    KYN39827.1    ADTU01020204    KQ976604    KYM79404.1    NEVH01020858    PNF21039.1    PNF21041.1    PNF21037.1    KQ982109    KYQ60000.1    GBYB01001768    JAG71535.1    GEDC01024062    GEDC01021433    JAS13236.1    JAS15865.1    GEDC01031434    GEDC01026722    JAS05864.1    JAS10576.1    KK853134    KDR10862.1    KZ288308    PBC28715.1    GBYB01001767    JAG71534.1    GBYB01009580    JAG79347.1    PNF21040.1    GEDC01000814    JAS36484.1    KQ414784    KOC61013.1    KQ759847    OAD62585.1    GEDC01023274    GEDC01010258    JAS14024.1    JAS27040.1    KQ971361    EFA08800.1    GEDC01016169    JAS21129.1    GEDC01030912    GEDC01010908    JAS06386.1    JAS26390.1    NNAY01002685    OXU20778.1    LJIG01001147    KRT85793.1    DS235392    EEB15529.1    GBBI01003783    JAC14929.1    GEZM01101576    GEZM01101573    GEZM01101570    GEZM01101569    GEZM01101566    GEZM01101565    GEZM01101553    GEZM01101549    GEZM01101547    JAV52508.1    GEDC01026348    JAS10950.1    GFTR01008638    JAW07788.1    GEZM01101567    GEZM01101556    JAV52523.1    KB632255    ERL90630.1    APGK01022082    KB740398    ENN80731.1    PYGN01002942    PSN29814.1    PNF21038.1    GBHO01045650    GBHO01045645    GBHO01026686    GBHO01026683    GBHO01026682    GBHO01026681    GBHO01026680    GBHO01026678    JAF97953.1    JAF97958.1    JAG16918.1    JAG16921.1    JAG16922.1    JAG16923.1    JAG16924.1    JAG16926.1    KQ435834    KOX71551.1    GDHC01003801    JAQ14828.1    GDHC01007108    JAQ11521.1    GEZM01101545    JAV52588.1    GGMR01012391    MBY25010.1    CH477937    EAT34941.1    ABLF02027300    JXUM01107644    JXUM01107645    JXUM01107646    KQ565160    KXJ71272.1    GDHC01006927    JAQ11702.1    KA648401    AFP63030.1    GDUN01000178    JAN95741.1    KK854009    PTY09219.1    BT125985    ADX35964.1    ACPB03015962    ACPB03015963    CH940649    KRF81941.1    CH902624    KPU74432.1    GECU01011041    JAS96665.1    GDHF01009982    JAI42332.1    CM002910    KMY88057.1    GFDL01009689    JAV25356.1    AE014134    AAN10345.2    AGB92559.1    CM000157    KRJ97269.1    KPU74431.1    KPU74433.1    AY051455    AAK92879.1    AXCN02001394    CH379060    KRT04430.1    GBYB01011032    JAG80799.1    KRJ97268.1    KMY88058.1    CH933807    KRG03524.1    GECU01032144    JAS75562.1    CP012523    ALC38747.1    CH954177    KQS70089.1    AAAB01008846    EAA06333.5    GFDL01009707    JAV25338.1    GAMC01018438    JAB88117.1    GAMC01018439    JAB88116.1    BT015990    AAF51018.3    AAV36875.1    KQS70090.1    KQ979658    KYN19892.1    KPU74430.1    EDV33368.1    EDW87631.1    CH477589    EAT38586.1   
Pfam
PF01027   Bax1-I        + More
PF00689   Cation_ATPase_C
Interpro
IPR039720   TMEM94        + More
IPR023299   ATPase_P-typ_cyto_dom_N       
IPR023298   ATPase_P-typ_TM_dom_sf       
IPR008250   ATPase_P-typ_transduc_dom_A_sf       
IPR006214   Bax_inhibitor_1-related       
IPR006068   ATPase_P-typ_cation-transptr_C       
SUPFAM
SSF81660   SSF81660        + More
SSF81665   SSF81665       
SSF81653   SSF81653       
Gene 3D

Ontologies

Topology

Length:
575
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.63919
Exp number, first 60 AAs:
0.00043
Total prob of N-in:
0.05127
outside
1  -  575
 
 

Population Genetic Test Statistics

Pi
38.474205
Theta
28.796124
Tajima's D
-1.005159
CLR
0.006784
CSRT
0.141142942852857
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号