SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16531
Pre Gene Modal
BGIBMGA005640
Annotation
Cockayne_syndrome_protein_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 3.689
 

Sequence

CDS
ATGGTGGACATAAACAAATATTTAGAAATGCAACTTGAATTAGCGAAAAAGCAAATTGAGAGGAAAAATAGTCAGAAAGAAGATGTATCAACTAAAAGCAAATCTGCTGCTGATTACATATCGCAAAAACAGGCAAAGACTCTGTCAAAATTTCCCCACAATCAAAAAGTAGATGTAAAAACTACTGTGACATCAGGGACTTCAACTGAAGGACACCTCGATGACATCGATTTTGTACCTTCCGATGAGGAAGACGACAGTATCCATAATTTTCCGCTTACTGCGTGTTCTTCTCGTACCAAACAGAATATAAACCGAATTGTTGACGACGGTGATATTAAACAATACAATTTAAGGGTAGAGGTTTGGCGTGAAGGATTAAATACTGTGAAAAGCGGTACATATGAAGGATGCACGTTAACCGCTGACATACAGTACATCCTGGATGGTAATAAAGATAGCGATGAAATGCATGAACTCCAGAATGGTCTATTAGTACCAAAATATATTTGGAAACAGTTATATAAATTTCAAAGAACTGGTGTTAAATGGCTTTGGGAGTTGCATCAAGTGGATTCTGGTGGATTGTTAGGTGATGAAATGGGACTTGGTAAAACAATACAAGTCATTGCATTCCTAACTGCCCTTTCAAAAACCAATTTAGGATCATGGGGTGGTCTTGGTCCGAGTATCATTATCACACCTGCAACAGTTATATATCAATGGGTATCTCATTTTCATTATTGGTGCCCCCTGCTCAGAGTAGCTGTACTGCATCACACTGGCTCTCATGCTGGTAATCACCATAAACTATTAAGGGATATACACAGTGCTCATGGAATCTTGTTAGTAACATATGCAGGCATAGTAAAGTATCATAAAGAACTTAATGCTTATAGTTGGCATTATTTAATTTTGGATGAAGGACACAAAATACGTAATCCTGATACACAAGTAAGTAAAATTGTAAAAAAAATCCAGACACCACACAGATTGTTAATAACAGGCTCACCAATGCAGAACAGTTTGCAGGAACTGTGGTCATTATTTGATTTTATGAGGCCAGGTTTGTTGGGGACATACAATGCATTCATAGAACACTTTGCAGTTCCAATCACTCAAGGAGGCTATGCTAATGCTACTGAAATACAGGAAGCTACTGCCATGGAAATAGCTATTGCTTTGAAAAATATGATCACTCCTTACATGCTGAGGAGAACTAAGGCTGAGGTACAAGGACATATCAAACTCCCAGAAAAGAATGAACAAGTTCTATTCTGTTCTTTAACACAAGAGCAAAGAGATCTTTATATGGGTTACCTTATGAGTAATACAGTGAGAAGCATCTTAGACAAAGAAAATAAATTTGGAAATCCATTAAGAGCGAGGCTACTAGTGGCTCTGTCAACGCTAAGGAAAATATGCAATCATCCTGATATTTATCTCTACGAAGCTCAAGAAGATGAAGAACAGATAGATGAAGAGATATTTGGCCATTGGAAGAGATCTGGAAAAATGACTGTTGTTAATTCATTACTTAAAATATGGAAAAAACAGGGACATAGAGCTCTCATATTCTCTCAGTCAAGAGTAATGCTGTGTCTGTTAGAACAGTATTTACAAAATCAAGGCTTTACATACCTCAAAATGGATGGTACAGTTAATGTTGGCCAAAGGCAAAACTTGATTAAAACTTTTAATGATAACACTGATTATTTAGTTTTTCTTTCCACAACTAGAGTAGGTGGCTTAGGTGTAAATTTAACTGGAGCCGACAGAGTGATAATATATGATCCTGATTGGAATCCTGCAACAGATGATCAAGCAAAGGAAAGAGCATGGAGGATAGGCCAGTCTAGAAATGTAACAGTTTATAGATTGTTGTCAGCTGGGACTATAGAGGAAAAGATTTATCAGAGGCAGATATTCAAACATTTCTTGAGTAATAAAATTTTTGTGGACCCAAATCAAAAGAATTTTTTAACCACCAGTACATTACAGGGACTGTTCACTCTTGAAGAGCTTAACCGTGAAGGAGATACTGAAACTGCATCAATTTTTAAACATACCAAAATTATCAATAAAACCAATAAGAATGATAATGACTTGGATATTTCATCTAAAACAAAGTTAGAAGCCATGAAAAGATTAGCAAAAGAAATAAGTAAAAAAATATCAAAAGAATCCATGAAGGGAACACAGGAAAGTGATCCACGTGAAGAATATAAAAAGAAAAGAGAACAATTATTATGTCCACCTAAAGTGGAAGAACCAGATATTAATTTAGTTGATGATAAAATAACCAATGTAGCTTTTGAAGATGTTTTGTCAGAATTAGATATTGTAAAAATGCATGCAAAGAAAGATTATGAAGAACAATTGTTGAAAAGTGTACTAGAAGATAATGAACAAGATATTAAAGAAGTAGATGAAGAGAAACCTACCAACATTGACAACTCTCAACTTGAAACTAATGAAAGTACTGTAAAAGATATTAAACAAAAGCATAAAAAATCACATAAAATAAAGCGCAAAAGAAGATTATCATCTTCCATTGATGATGGACTCAAAAATTTAGTAACTGTAAAGAAAGTAAAGAAAAAGGATTATAGTAAAAATGAAGTAAAGAAACAAACTAATGATGATGACTATGTGTTAAACAAACTTTTTGCTAAAGCAGCAGTGAAAAACGCGTTACAACATGATGTGGTAGTTGGTTTAGCTGAAAGAGAAAAAAAACATAGATTGAAAGAAGAAGCTGCTAAAAGAGCTCGCAATGCGGTTAGAGCTGTTAAATTTTCATCAAAATAA
Protein
MVDINKYLEMQLELAKKQIERKNSQKEDVSTKSKSAADYISQKQAKTLSKFPHNQKVDVKTTVTSGTSTEGHLDDIDFVPSDEEDDSIHNFPLTACSSRTKQNINRIVDDGDIKQYNLRVEVWREGLNTVKSGTYEGCTLTADIQYILDGNKDSDEMHELQNGLLVPKYIWKQLYKFQRTGVKWLWELHQVDSGGLLGDEMGLGKTIQVIAFLTALSKTNLGSWGGLGPSIIITPATVIYQWVSHFHYWCPLLRVAVLHHTGSHAGNHHKLLRDIHSAHGILLVTYAGIVKYHKELNAYSWHYLILDEGHKIRNPDTQVSKIVKKIQTPHRLLITGSPMQNSLQELWSLFDFMRPGLLGTYNAFIEHFAVPITQGGYANATEIQEATAMEIAIALKNMITPYMLRRTKAEVQGHIKLPEKNEQVLFCSLTQEQRDLYMGYLMSNTVRSILDKENKFGNPLRARLLVALSTLRKICNHPDIYLYEAQEDEEQIDEEIFGHWKRSGKMTVVNSLLKIWKKQGHRALIFSQSRVMLCLLEQYLQNQGFTYLKMDGTVNVGQRQNLIKTFNDNTDYLVFLSTTRVGGLGVNLTGADRVIIYDPDWNPATDDQAKERAWRIGQSRNVTVYRLLSAGTIEEKIYQRQIFKHFLSNKIFVDPNQKNFLTTSTLQGLFTLEELNREGDTETASIFKHTKIINKTNKNDNDLDISSKTKLEAMKRLAKEISKKISKESMKGTQESDPREEYKKKREQLLCPPKVEEPDINLVDDKITNVAFEDVLSELDIVKMHAKKDYEEQLLKSVLEDNEQDIKEVDEEKPTNIDNSQLETNESTVKDIKQKHKKSHKIKRKRRLSSSIDDGLKNLVTVKKVKKKDYSKNEVKKQTNDDDYVLNKLFAKAAVKNALQHDVVVGLAEREKKHRLKEEAAKRARNAVRAVKFSSK

Summary

Pfam
PF00176   SNF2_N        + More
PF00271   Helicase_C
Interpro
IPR014001   Helicase_ATP-bd        + More
IPR001650   Helicase_C       
IPR027417   P-loop_NTPase       
IPR038718   SNF2-like_sf       
IPR000330   SNF2_N       
SUPFAM
SSF52540   SSF52540       
Gene 3D
PDB
5VVR     E-value=6.21939e-132,     Score=1209

Ontologies

Topology

Length:
936
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.84395
Exp number, first 60 AAs:
0
Total prob of N-in:
0.08040
outside
1  -  936
 
 

Population Genetic Test Statistics

Pi
4.92906
Theta
15.389804
Tajima's D
-2.013367
CLR
0
CSRT
0.0117494125293735
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号