SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16527  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005637
Annotation
putative_penguin_[Heliconius_melpomene]
Location in the cell
Nuclear   Reliability : 3.629
 

Sequence

CDS
ATGCAGAAAGGTAAAAGGAAAAGTGATGAAGATGGTGTTAGTTCACCAAAAAAGAAAAAACTAAATAGTTCGCAAACAACAGTTCGCAAAGAACAAGATAGTAAAATTAAAAACATCAAAAACAAAACAAACCTAAAAGGTAAAAAAAATAATAAGGATGGATTAAAAGGTTTCAAAAAATTTACTAAAAACGACAAAGGATCTAAATTTGTTAAAACAAAAGAAAAATCGAATTTTTCTAAAGATGAAGCAAACGGAGAAAAGCCAAAATGGGCTGAAATGAAAAAAGAGAAAAAACAATTAAGGACTGTAAGACGTAAAGCTAAAATAACAGCTGAAGTATTTGAGATTTCACATAAGGCCAAGTTGTTAGCAGCACAAATACAGAGAAAAGTTGTGAAATCTGACTTCAAAATAAACTCCTGTAAAGAATTGCACAATATGTTAAAGGGACAATACAAGTCTATTGCTCTCACTCATGATCTCAGTCGAGTTATTCAAGTTCTACTAAAACATAGCCCTGAAGACATTATAAATGAAATAACGAAAGAGCTTCTAGACATTATAGTACAGATGGGTCAATCTAAGTATGCGCATCATTCCGTTAAGCGAATACTGAAATATGGAACAGATTTCATTAGGCATGAGGTTTTGAAGAAGTTTTATGGACATGTTGTATCCCTGTCAACTCATGCTATTAGTGCACCTGTCTTGGATTATGCATATGGGGAGTTTGCCTCGAAAAAGGAAAAATGCCACATGCAACAAGAATTCTATGGAGAGATTTATAAGAATACAAAAGACGACAAGGTAAAGACACTCAGAGATGCATACAAAGACAGTCCAGAAATGAAATCAGCTATACTCCAGGCCTGTAAGGCCAACTTACAGAAGATATTAGACAAAAACCTACATGATGGAGAATTGTTTCATTCTGTGTTATATGACTATATCTGTGAATGCAGCCAAGAAGATAGAGTAGATTTTATTTCTATTCTTAGCCCACTGATTGTCCCACTCAGTAATTCTTTACCTGGTGTCAATGCTGCCAGTATGTGTGTTTGGCAGGGTACAAATAAGGACAAGAAAACAATTTTAAAAGTGGTCAAGGAACATGCTATTCCTTTAAGTAAACATAAGACTGGATACCGCCTTCTGATTGCTATTTTTGACTCTGTTGACGATACTGTTCTTGTCAAGAAGACTATTGTGTCCACTCTGGCTGCCAATATAAAAGACATTGCTAAGGACCACTGGGGTAATATGGTAATTCACTGGTTAGTAAAACCAAAAGACACAGCTGCTTTCCATCCTTGTTTAATTAAGTTTTTGGAAGATGGTGCTAAGAGTGGAACATCGAAGAAAGACACAGAAATTCGTGTTTCGGAGCTTAGGGAAGCTATATTACCTGCTCTAAAGAAAGATATGGAAACAGATCCTAAATTCTGGCTAAGCAATAAATCTAATATGTTGTTGGCTGTTGCTGTATTGTCTATAGAATCATCTAAAGAGATTCTGCATGCATTGGCAAAAGTGATCTGCGAGACTGACTGGCACATGCAGGTGGAAGGGAAGGACGATACCCTGGCGATTGAGGATGCTGGTATACACATGTGCTTAAAAAAACTAGCCAGTTTAGACAAAGAAAAATCGGCTGATACTCTTGGTGAAGCTATAAGTGAACATTTAAATGATGAAACTATTAAAGTGTGGATACGTACAAATAGGGGTTGCTTTTTCCTATTGAAATTGATAGAGAGTAATAGTGAAGAAGTAGATAAGAAATTAAAGGCAAAATTAAAACCACATGTAAATATTTTGAAGCAACAATCATCGGAAGGTGCTAAATTATTGTTACAGAATGTACAGAATAAATAG
Protein
MQKGKRKSDEDGVSSPKKKKLNSSQTTVRKEQDSKIKNIKNKTNLKGKKNNKDGLKGFKKFTKNDKGSKFVKTKEKSNFSKDEANGEKPKWAEMKKEKKQLRTVRRKAKITAEVFEISHKAKLLAAQIQRKVVKSDFKINSCKELHNMLKGQYKSIALTHDLSRVIQVLLKHSPEDIINEITKELLDIIVQMGQSKYAHHSVKRILKYGTDFIRHEVLKKFYGHVVSLSTHAISAPVLDYAYGEFASKKEKCHMQQEFYGEIYKNTKDDKVKTLRDAYKDSPEMKSAILQACKANLQKILDKNLHDGELFHSVLYDYICECSQEDRVDFISILSPLIVPLSNSLPGVNAASMCVWQGTNKDKKTILKVVKEHAIPLSKHKTGYRLLIAIFDSVDDTVLVKKTIVSTLAANIKDIAKDHWGNMVIHWLVKPKDTAAFHPCLIKFLEDGAKSGTSKKDTEIRVSELREAILPALKKDMETDPKFWLSNKSNMLLAVAVLSIESSKEILHALAKVICETDWHMQVEGKDDTLAIEDAGIHMCLKKLASLDKEKSADTLGEAISEHLNDETIKVWIRTNRGCFFLLKLIESNSEEVDKKLKAKLKPHVNILKQQSSEGAKLLLQNVQNK

Summary

EMBL
NWSH01001832    PCG69966.1    ODYU01003152    SOQ41542.1    KQ459232    KPJ02633.1    + More
KQ461155    KPJ08300.1    FP102340    CBH09284.1    KC469893    AGC92694.1    GAIX01003617    JAA88943.1    AGBW02013517    OWR43288.1    JTDY01000686    KOB76223.1    KQ971363    EFA09038.1    APGK01041594    KB740994    KB632255    ENN75986.1    ERL90654.1    LJIG01016117    KRT81565.1    GEZM01035601    JAV83159.1    NNAY01001792    OXU22907.1    AAZX01002711    GL451265    EFN79580.1    KQ434896    KZC10744.1    LBMM01014327    KMQ85219.1    GL762880    EFZ20617.1    PYGN01001432    PSN34880.1    GL437382    EFN70542.1    KK107374    EZA51594.1    QOIP01000010    RLU18102.1    KQ980989    KYN10708.1    KQ976528    KYM81867.1    ADTU01024454    NEVH01013260    PNF29156.1    GDHF01022839    JAI29475.1    GL888186    EGI65579.1    KQ981208    KYN44654.1    KQ983136    KYQ47082.1    GANO01003004    JAB56867.1    KK853308    KDR08684.1    RLU18103.1    GAMC01010297    GAMC01010295    JAB96258.1    UFQT01001201    SSX29481.1    UFQT01001175    SSX29325.1    KQ978457    KYM93817.1    AJVK01011378    AJVK01011379    GFDF01008496    JAV05588.1    CVRI01000066    CRL05875.1    JXUM01114779    JXUM01114780    JXUM01114781    JXUM01114782    JXUM01114783    JXUM01114784    KQ565817    KXJ70629.1    AJWK01018717    ATLV01013862    KE524905    KFB38217.1    GGFK01007636    MBW40957.1    GGFK01007598    MBW40919.1    GGFM01002212    MBW22963.1    GGFM01002187    MBW22938.1    GGFK01007750    MBW41071.1    CH477622    EAT38180.1    PZQS01000010    PVD23157.1    GGFJ01002986    MBW52127.1    AXCM01006361    AAAB01008898    EAA09186.4    CH964239    EDW82601.2    APCN01004963    KK854135    PTY11899.1    GL732528    EFX87453.1    GDIP01092481    JAM11234.1   
Pfam
PF08144   CPL
Interpro
IPR040059   PUM3        + More
IPR016024   ARM-type_fold       
IPR001313   Pumilio_RNA-bd_rpt       
IPR012959   CPL_dom       
IPR011989   ARM-like       
IPR033133   PUM-HD       
SUPFAM
SSF48371   SSF48371       
Gene 3D
PDB
4WZW     E-value=3.83217e-50,     Score=502

Ontologies

Topology

Length:
625
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.14368
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00960
outside
1  -  625
 
 

Population Genetic Test Statistics

Pi
2.314358
Theta
23.462693
Tajima's D
-1.321643
CLR
0.003159
CSRT
0.0837458127093645
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号