SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16521
Pre Gene Modal
BGIBMGA012137
Annotation
PREDICTED:_major_facilitator_superfamily_domain-containing_protein_6-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.305
 

Sequence

CDS
ATGAAGATTAACAAAAGCTTGCTGCCTGTAAAGGCGCATTTCTTCTTTTTCTTCGCCGCCCTGGGGCCGCTGTTGCCGCAAATGAATGTGTTCGGGCGGCAACTGGGAGTCACGCCCGCAGCGATGGGAATCGTGACGGCGATTCTGCCCCTGCTGTGGGCGACTGCGAAGCCACTCTTCGGCTACGTTGTAGATTATTGGCCGGCGCACAGGAAGCTAGTATTCATGCTGCTAATATCGGTTATGACCGGCTCGTACTGTTGCCTCTGGTTCTTGCCCACCCCGGAAACCGTCGAGCCGCCCCTCCTGGAATACGTTTATAAACTGGAAACCGTTGATTTGAGACGAAACGATCAGTCCCTGAACCTAGAAAAGTACACGTGCCACTGGAATTGTACTCCGGGAACGTTCGATGTGTACCTGCGGAACACGACCCTTATCGATACAGCATACTTGGACAGTGACGTCACGAATTCGACCTGTCTGACCCTGAACATGGACTTAAGCGAAGTCCGAGACGGGCAAGTGAAGTGCACGCCCAGAGACGGCTGCGATTTGTTGTGCTACGAAAAGGGATTGAATCGAGTCAAAAGAGAGATATCAGGTTCCACTAAGAATTTGGTTGACGTTAACGAGAAGATCTCTGGTGATTCTTCTGTTGAAACGGGGGGAGGAGGTAGCGTCTATGTGAGTCTTACGTTTTGGGCGTTCGTGGTTCTGATGAGTCTGGGTACAGTGGCGTTTAATGTGGCCAATTGTATCGGTGACGCCGTGTGCTTCGACGTGCTTGGTCCAGATCGAGGATCGAAATACGGTGCCCAACGAGCTTGGGGCACTATCGGATATGGGGTGACGGCCCTGCTGGGAGGTTGCCTGGTGGATATGGTATCTGATGGCAAGTACAAGGACTACACGCCGGCGTTCGTGATAGCCCTAATTGCGACCGGCATCGATCTTTATAGCTGCAGAGCGTTGACGCTACCCTCATTATCGAGCCCCACCGATTCCGGTGCGGCATTACGTTCTGTACTGCGGATACCGAAGGTGATTGTGTTCATAGTGTTCGCCGTACTGGCGGGCACATTCGACAGCTTCATAATCTATTACATGTTCTGGTTCCTGGAAGAATTGGCCGAGGAAACCGGTTCGATTGCTACGATAAAGCTCATCGAGGGCGTGGTGGTAGCCGCGCAGAGCTTCGTCGGGGAGCTTCTGTTCTTTTTCTGTTCAGGTAAAATAATAAAGCGCTGGGGCTACGGAACGACGCTGACGTTTTCATTGTTCTGTTACGGAATTAGAATGGCGTTGATATCGTTCATTCGGAATCCGTGGCAATTGGTGTTGATAGAGGGGATTATGCAAGGCCCGACATATGCCCTTTGCTACGCTACTATAGTCGGGTACGCGGCTCATGTGGCCCCGGACGGTTACTCGGCGACTGTCCAGGGCATAGTGGCCGGCATGGACGACGGCGTGGGTTTCGCCCTGGGATCGCTGCTAGGCGGACAACTGTACGGTTCGATGGGCGGTCGATATTCGTTCCGAGTGTTCAGCGTATTGGCGGTGATCGCGGCCGCCCTGCACGCCGCAATGTTCTTGGAATTCGATCGGGCTGCAGATTCCTGTTGGACGAATGACGATGGTGATAAGCCGAAGGTGACTCGGTTCGTTGGTAGACGCCAATCAGAAGTGGATGAAGACTGTGATGATTATAATTATGATGATGTCGTAACGCCTGATGATTTAGAGGAATACCAGGATTCAGACACGCGAGATTGCGATGAAAACATACAAATAGAAACGGTATATTGTTATGAAGACGATTCCACTTGTTATGTTGATAATAATAATGATGATGATGATTGA
Protein
MKINKSLLPVKAHFFFFFAALGPLLPQMNVFGRQLGVTPAAMGIVTAILPLLWATAKPLFGYVVDYWPAHRKLVFMLLISVMTGSYCCLWFLPTPETVEPPLLEYVYKLETVDLRRNDQSLNLEKYTCHWNCTPGTFDVYLRNTTLIDTAYLDSDVTNSTCLTLNMDLSEVRDGQVKCTPRDGCDLLCYEKGLNRVKREISGSTKNLVDVNEKISGDSSVETGGGGSVYVSLTFWAFVVLMSLGTVAFNVANCIGDAVCFDVLGPDRGSKYGAQRAWGTIGYGVTALLGGCLVDMVSDGKYKDYTPAFVIALIATGIDLYSCRALTLPSLSSPTDSGAALRSVLRIPKVIVFIVFAVLAGTFDSFIIYYMFWFLEELAEETGSIATIKLIEGVVVAAQSFVGELLFFFCSGKIIKRWGYGTTLTFSLFCYGIRMALISFIRNPWQLVLIEGIMQGPTYALCYATIVGYAAHVAPDGYSATVQGIVAGMDDGVGFALGSLLGGQLYGSMGGRYSFRVFSVLAVIAAALHAAMFLEFDRAADSCWTNDDGDKPKVTRFVGRRQSEVDEDCDDYNYDDVVTPDDLEEYQDSDTRDCDENIQIETVYCYEDDSTCYVDNNNDDDD

Summary

EMBL
BABH01031908    BABH01031909    ODYU01002673    SOQ40474.1    KQ460648    KPJ13153.1    + More
RSAL01000132    RVE46368.1    KQ977104    KYN05808.1    KQ983238    KYQ46342.1    KZ288266    PBC30248.1    KQ981512    KYN40876.1    KK853097    KDR11427.1    GL888284    EGI63268.1    KQ976532    KYM81655.1    KQ978884    KYN27677.1    ADTU01027161    GL451937    EFN78175.1    NEVH01003746    PNF40181.1    PNF40182.1    AJWK01000310    AJWK01000311    AJWK01000312    AJWK01000313    AJWK01000314    CVRI01000047    CRK98393.1    KQ434948    KZC12393.1    GFDF01009258    JAV04826.1    GFDF01009259    JAV04825.1    GDHF01025120    JAI27194.1    PYGN01000948    PSN39063.1    GDHF01026511    GDHF01003173    JAI25803.1    JAI49141.1    GDHF01022509    JAI29805.1    GAKP01011016    JAC47936.1    GAMC01020117    JAB86438.1    JRES01000264    KNC32853.1    KA645081    AFP59710.1    OUUW01000001    SPP72891.1    CCAG010014016    JXJN01022164    JXJN01022165    CH963846    EDW72578.1    GL766597    EFZ15023.1    CH954179    EDV55797.1    GFDF01009385    JAV04699.1    GBXI01013198    GBXI01012822    GBXI01007590    GBXI01005757    JAD01094.1    JAD01470.1    JAD06702.1    JAD08535.1    CM000362    CM002911    EDX07322.1    KMY94211.1    AE013599    AY121685    AAF58040.2    AAM52012.1    GFDF01009386    JAV04698.1    CH480816    EDW48100.1    CH940648    EDW60785.1    KRF79615.1    KRF79616.1    KRF79617.1    KRF79618.1    CH479183    EDW36205.1    CH902619    EDV35823.1    KPU75843.1    KPU75844.1    KPU75845.1    KPU75846.1    CH916367    EDW00756.1    CM000071    EDY69160.1    KRT02513.1    AAZX01004900    CH933808    EDW10197.1    KRG05084.1    KRG05085.1    KRG05086.1    CP012524    ALC42236.1    CM000158    EDW91966.1    KRK00222.1    KRK00223.1    KRK00224.1    KQ971311    EEZ98879.1    KQ435803    KOX73092.1    GFTR01006948    JAW09478.1    GEZM01048925    JAV76277.1    GEZM01048936    JAV76264.1    GEZM01048932    JAV76268.1    GEDC01023752    JAS13546.1    KB631840    ERL86606.1    APGK01049324    KB741149    ENN73680.1    GL888102    EGI67532.1    LJIG01001848    KRT85092.1    KK854307    PTY14440.1    KYN05805.1    KYN05807.1    KQ981606    KYN39670.1    KYB29460.1    KQ978081    KYM97095.1    ADTU01026274    GDHC01011273    GDHC01006315    JAQ07356.1    JAQ12314.1    KYQ46343.1    KQ976425    KYM88055.1    KYN05804.1    KYN40875.1    KYM81654.1    KQ978782    KYN28461.1    ADTU01027162    ADTU01027163    ADTU01027164    KYN39671.1    KYN40874.1    ADTU01017950    ADTU01017951   
Pfam
PF12832   MFS_1_like        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF07716   bZIP_2
PF07690   MFS_1
Interpro
IPR036259   MFS_trans_sf        + More
IPR020846   MFS_dom       
IPR024989   MFS_assoc_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR004827   bZIP       
IPR011701   MFS       
SUPFAM
SSF103473   SSF103473        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
621
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
233.63276
Exp number, first 60 AAs:
40.02826
Total prob of N-in:
0.99070
POSSIBLE N-term signal
sequence
inside
1  -  12
TMhelix
13  -  32
outside
33  -  41
TMhelix
42  -  64
inside
65  -  72
TMhelix
73  -  95
outside
96  -  231
TMhelix
232  -  254
inside
255  -  274
TMhelix
275  -  297
outside
298  -  306
TMhelix
307  -  329
inside
330  -  349
TMhelix
350  -  372
outside
373  -  416
TMhelix
417  -  439
inside
440  -  445
TMhelix
446  -  468
outside
469  -  482
TMhelix
483  -  505
inside
506  -  511
TMhelix
512  -  531
outside
532  -  621
 
 

Population Genetic Test Statistics

Pi
5.369732
Theta
17.389112
Tajima's D
-1.411919
CLR
0.105418
CSRT
0.0671966401679916
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号