SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16505  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004546
Annotation
PREDICTED:_titin-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.398
 

Sequence

CDS
ATGGGGGTCACCGACGACTTTGCCCCGAGCTTCACGCAGAAGCCGCAACTGCGGCAAGAGGACGATGGGAACAAGCTGGTTTTCGAATGTCAGCTACTCGCGTCGCCCAAGCCAGAGATCAGCTGGTTCAGAAGCGATGAACAGCTCCAAGAGGACAACAGAACTAAATTTAAGATCCAAAGCATCGCCAACAACAAATTCCTGGTGGTGCTCGAATTGGATGATGTGATCGAGACCGATGCGGGGCTTTACAAAGTTAAGGCCAAAAATAAGATGGGCGAGGTGGCCGCATCCATCAACCTTAATTTTAGCCCCGCTGACGAAGAGAAACAGAAACAACCGGACGGTAAAGCGCCAACGTTCGCGCGTAAACCGGCCATCAGACAAGAAGACGATGGCAAACGGTTGATATTCGAGTGCCGCATTGAGGCTGAGCCTGTACCCGGCGTGACCTGGTTCCACAATGCCGTGGAAGTAAAACCCGGAGCAAGACATAAGTTGACAGTAAGCAAGGAAGGCAAATCGTACTATGCCTCGTTGGAAATCAACAATGTAACCGTTGAAGATGCCGGGAAGTACAAGGTTACAGCTAAAAACGAACTCGGCGAAAGCAACGCCACGATCAGCTTAAATTTCGACAGCGACGAAGCGCCCGTACCTGAGGACTTTATCAAACCAACGTTCACGGAAAGACCGGTCATCAGGCAATCGGACGATGGTACCAAAATCACATTCGAATGCAGATGTGTTGGCAAACCGAAACCAACCATAGCCTGGTACCATGGCAAAAAAATGATAAAAGAAAGTAGCAGATATAAAATAACGTTAGAAGAGGATCAAACTCTGTATCACATGGCACGACTCGAAATCATAGGCGTAGAGAATTCGGACAGGGGAGAATATAGGGCTTTAGCGAAAAACAAGCATGGTGAAGGTGTAGCGAAAATAAATCTAAATTTCGAAGGAGGAGATAAACCTAAAATCCCCGATGGTAAAGCACCAAGGTTCCCTAAAAAGCCTACGATAAGACAAGAAGGGGACTTATTGATAATGGAATGTGTGCTTGAGGCTTATCCAGTCCCAGACATCACATGGTTTCATGGAGACAGAGAAATTAAAGACGGTCCAAAAATGAAGATGTCTAGAAAAGCAACTGGAAAAGATACATTTAATTTAACACTAGAAATTTTGAGTCCTTCTAAAGAAGACGGGGGAAACTATAGGTGTAATGCCTTCAACTTGTTTGGTGAGAGCAATGCCAACATTGCTCTAAATTTCCAAGGTGGGGATGATGAGAACGGTTTCGCACCGTCGTTCGTGGAGAAACCCCGAATCATTCCCAATGAAGATGGTACACTCATTACGATGCGTTGTGTCTGCAAAGCCAAGCCGGCGGCCGAAGTATCGTGGTACAGGGGCACGACGGTCATCAAGGCTAGTAGTAAAATTGAAATCAAATCTAGTAAAATTGAAGAGGATGTTTATGAACTGTTCTTGCTTTTAACAAATCCGACGGCAGCGGATGGTGGCGCTTACCGCTGTCATGTCAAGAATGAATTTGGTGAAAGCAATGCTAATATCAATTTGAACATCGAAGCCGAACCCGAACCGGAGGGAGAAGGCCCGACGTTTGTCGAGAAACCTACCATTCAGTCCAAAGACAACGGCAAATTAGTCATAATGGGATGCAAGGTCAAAGCTAGCCCGAGACCGACTATCGTGTGGTACCACGAGGGTAAAGAAATCAAGGAATCATCGAAAATTAAGACCAGGATTGAAGTACATGAAGACATTTACACAATTATCCTAGAACTTATCGATCCTGGCATCGAAGACTCCGGATTGTATAAATGCAATATCAAAAATGAACTTGGAGAGCTCAATGCGAATTTAACGCTCAATATTGAAATCATTCCAGTTATCAAGGAAAAGCCAAAGATCATTAAGATAGTTAAGAAGAAGACTGTTATTGTTGAATGTAAAGTATTAAGTAAATTTGCACCTCAATGTACTTGGTTCAAAGAAGCCAGTGCTGTCAAAGAAGACTCTAGGCATACTGTGCTAATTGAACCTGTGAGAGAGGGTGAATTCGCAGTCAAATTGGAAATCTCAAACGTTTCACAAACCGACAAGGGTTCGTATAAACTCGTTGCTAAGAACGAGAAAGGTGAGGCCACATCGCAACAAGTTGAAATCACAGAGATTCCTGAGGAGAAAGGAGAAAAGCCTCATATCATCAAACACCTCAGGAGCTTGGCTAGAAAAGAAAACGAGGAAGCTGAATTTATCGCCGTCCTCAAAACATCAGATCAGTCATGTCGATGCACTTGGTACAAAAACTCCACCGTCATCAGAGATACATCTGAAGTGAACACATCTTTTGATGGTACCAACGCTAGACTCATCATTAGAAAGGTTTCTTCGAAATACGTTGCCAACTACAGAGTTGTGATTAAGAACGAATACGGCGAAGACGAATCTAGCGCAGATTTGACTATTGTTGATGAAAAGAAAAAGAAAAAGGAGGAGGAAGAAGAAGAAATCACTGTTATCGAAGAGTCTGAAGAAGAAATGTCGATCGTGGAAGAGAAATCAATAATTGAAGAAAACCACGTAGATGAAAAGAAAAAGAACGAAGAAATAAGAAAGAAAGAAGAAGAAAAAACGACAATTGAAGAAAAGAAAACGGCATCCAAAAAAGTGACTAAGAAAGGACAAATTACAATAGAAAATAACCAAGAGGAAATGGAGATTGAATCTAAAAAGGCTGACTCTAAAGTTGAATCCAAGAAAATTGAGACCAAAAAGGAAGAAATAAGAAAAGCAGAATTAGAAGCCGAAGAGGCCAAAAAAAATATCGAAAAGAAAACAAACAAGACTGAGGAAGAGAAGAAAGCTCTACTTGAAAAACTTGAGAAAAAGAAGCCTGAACCTGAGCCTGAGAAAAAGATTGAAGGTATTCCTAAGCTGAAATCGGTGAAACCCAAGGAAGAACCTGTCGAAACCAAAAAGGAGGTATCTAAAAAATCCACAGAAGAAAAGAAAAAAGTGGTTAAAAAGAAGGTTGTTGCTAAAAAAGAGGAGGATGAAATCGAGTTCGTCGATGATTACGAGCGTCCAGTTCTGGAGAAATATGAAAAGATTACACCGACCCCTCTTGCTAAAAAAGCAAAACAGGATGACACACCAAAGGGTAAACGCGCATCAGTTTCGGAAAGCGTTAAAAGTGAACAATTCAGTGAAGATGAACCTTCTATTGCTGAACCGACCCCTGAGAAAAAAACCAAGGTTGAATTTAACGATAAGGTCGACGAAGACAAGGCTGAGCCTAGGAGATCAAGTATTAAAAAAGGCATTCCCAAACCAGAGGAGCCGGTAGATGAACTAACAAACATCAAATTATCAAAAAAACCATCTAAACAAATCGAGGAACCGCTTGAAGAACCACAAGTAGCTAAAACAAAAAAACCAGTCCGAAAGCCGGGTGACACTGACGAATTCATTGACGATTACGAACGGCCAGAGTTGGAGAAATACGATAAACTGACGCCAACTCCTTTAGATAAAACCAAAAAAGTGAACGGAGTTGATGAGGCTGATTCGAAATTCGTGGACGATTACGAAAAGCCCGAACTTGAGAAATACGAAAAAGTAGCACCAACACCCAAAGACAAACGTCGAACTAGTGATACACAGGACGATGTGGATATGATGAAGGGTAAAATTAAACCAAAAGAGAAAGAAGAAGAACCGGAAATGCCTACACTACGCAAACGTCCTGTCCAAAAAGACAAGGAGCAAGAACCAAAACCAGAGGAGAAACCTAAAACAAAATCCATTAAAAAGGATGAACCGGAAACCAAAAAACGACCCTCACTCAAAAAGAAGGAGGTTGTCGAGGAAGAGTTCGTCGACGATTACGAAAGACCAGTCCTCGAGAAATACGAGAAAATCACACCCACACCACTCGAGAAAAAGAAAAAGGAGGATAAGAAAGCAGAAGAAGAAACACAGTCCACCACGGCAACTAGGCGACGTTCTGTCAAAGACAAAGAGAGTGCTAAACCAGAGGAGGACAAAAAACCAGATGAAGAAACGCCTTCCGCAACAGCGACTAGGCGGCGATCTGTCAAAGACAAAGACAATGACAAACCAGAGCCTATGGATGTTGATGAAAACTTCAGCATTACCAAACCTAAGACTCCGGCTAAGCCTGGACAAGAACCTGAAACATCACTTACACACAAAACACCGGCTGAAATTAAGCCTACGGAAGACGAGGCTGAAGCCAAACTCCACGTTAAGAAACCAGAGATCATTGAAGAAAAAACACTTAAGAGACCTTCACCTAAAGATAAAGAACCTAAGGAAGACGACACAGAGGAGGCTGTCAGTCTCAGCAAACCGCGCAAAAAGACAAGCACGACTGCTCCCGAAGAGGCGCAGCTCACACAAAAGACTCCTGCTAAGAAAAAACTAACGGAGGGTGCTGAAGCAGCAACGTTAAAGGTCAAAAAACCTGCTGTTGTCAAGAAAGATGACGACCAAGAGTATGAGCTTGACTTTGTGGATGACTATGAGAGGCCTGTACTGGAGAAATATGAAAAGATTAGCCCGACACCGATTGTCAGGGAGAAGAAAGAAAAAGAAACCAAGACTGAAAGCAGAAGAACTTCGATTCAAAGCGAGGTTGTATTATTATTCCCCTTACTTTTTTTAGTTTAG
Protein
MGVTDDFAPSFTQKPQLRQEDDGNKLVFECQLLASPKPEISWFRSDEQLQEDNRTKFKIQSIANNKFLVVLELDDVIETDAGLYKVKAKNKMGEVAASINLNFSPADEEKQKQPDGKAPTFARKPAIRQEDDGKRLIFECRIEAEPVPGVTWFHNAVEVKPGARHKLTVSKEGKSYYASLEINNVTVEDAGKYKVTAKNELGESNATISLNFDSDEAPVPEDFIKPTFTERPVIRQSDDGTKITFECRCVGKPKPTIAWYHGKKMIKESSRYKITLEEDQTLYHMARLEIIGVENSDRGEYRALAKNKHGEGVAKINLNFEGGDKPKIPDGKAPRFPKKPTIRQEGDLLIMECVLEAYPVPDITWFHGDREIKDGPKMKMSRKATGKDTFNLTLEILSPSKEDGGNYRCNAFNLFGESNANIALNFQGGDDENGFAPSFVEKPRIIPNEDGTLITMRCVCKAKPAAEVSWYRGTTVIKASSKIEIKSSKIEEDVYELFLLLTNPTAADGGAYRCHVKNEFGESNANINLNIEAEPEPEGEGPTFVEKPTIQSKDNGKLVIMGCKVKASPRPTIVWYHEGKEIKESSKIKTRIEVHEDIYTIILELIDPGIEDSGLYKCNIKNELGELNANLTLNIEIIPVIKEKPKIIKIVKKKTVIVECKVLSKFAPQCTWFKEASAVKEDSRHTVLIEPVREGEFAVKLEISNVSQTDKGSYKLVAKNEKGEATSQQVEITEIPEEKGEKPHIIKHLRSLARKENEEAEFIAVLKTSDQSCRCTWYKNSTVIRDTSEVNTSFDGTNARLIIRKVSSKYVANYRVVIKNEYGEDESSADLTIVDEKKKKKEEEEEEITVIEESEEEMSIVEEKSIIEENHVDEKKKNEEIRKKEEEKTTIEEKKTASKKVTKKGQITIENNQEEMEIESKKADSKVESKKIETKKEEIRKAELEAEEAKKNIEKKTNKTEEEKKALLEKLEKKKPEPEPEKKIEGIPKLKSVKPKEEPVETKKEVSKKSTEEKKKVVKKKVVAKKEEDEIEFVDDYERPVLEKYEKITPTPLAKKAKQDDTPKGKRASVSESVKSEQFSEDEPSIAEPTPEKKTKVEFNDKVDEDKAEPRRSSIKKGIPKPEEPVDELTNIKLSKKPSKQIEEPLEEPQVAKTKKPVRKPGDTDEFIDDYERPELEKYDKLTPTPLDKTKKVNGVDEADSKFVDDYEKPELEKYEKVAPTPKDKRRTSDTQDDVDMMKGKIKPKEKEEEPEMPTLRKRPVQKDKEQEPKPEEKPKTKSIKKDEPETKKRPSLKKKEVVEEEFVDDYERPVLEKYEKITPTPLEKKKKEDKKAEEETQSTTATRRRSVKDKESAKPEEDKKPDEETPSATATRRRSVKDKDNDKPEPMDVDENFSITKPKTPAKPGQEPETSLTHKTPAEIKPTEDEAEAKLHVKKPEIIEEKTLKRPSPKDKEPKEDDTEEAVSLSKPRKKTSTTAPEEAQLTQKTPAKKKLTEGAEAATLKVKKPAVVKKDDDQEYELDFVDDYERPVLEKYEKISPTPIVREKKEKETKTESRRTSIQSEVVLLFPLLFLV

Summary

Uniprot
ProteinModelPortal
PDB
3B43     E-value=2.09447e-32,     Score=353

Ontologies

Topology

Length:
1574
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00048
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1574
 
 

Population Genetic Test Statistics

Pi
22.760382
Theta
24.002016
Tajima's D
-0.79661
CLR
0
CSRT
0.178341082945853
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
26822097 SIIEENHVDEK 100.00 2e-09
28467696 IEAEKDEIQAAIEEAEAAIEQEENK 100.00 2e-09
28467696 GEAFTSSTVYCTSK 100.00 0.002
26822097 KIEEETQSTTATR 100.00 0.042
28467696 DTSEAIEVIEIAIQQQIK 100.00 0.042
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号