SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16494
Annotation
retroelement_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.92
 

Sequence

CDS
ATGGAGAAATTAAGATTTGATTTTGCAATGAAATCAATGGCGGATGGAAAAACAAACGTCATATGCATAACTTCCATTGCTACACCAAGTGGACAAGTTTTTGGAATTCCAGTCGAATATCAACCCGTAAATCTTCATAAGGTGATCACAACTACTCCTAACTACACTAGAGTAAAAAACTCTTTAGTAAAAACGCATCAAACGAGGAAAATATGGATAACTGTGACGGAGGAAATTTCAAAAACATATTTGGATGAAGAACAAAATTTGCAATTCAATGATTGTTATTTGGAAGAGATTTCAGAACAACCTGTTAGTTATGAATCGACATCTAGTGATTCTAATCACATGCTTGAAAAACTGTTAGAAAAACTACAAGAACAAAAACAGCAGAAACCAGAAAAACAAAATTTAGGGAAAATTGCAAAGGATTTTATTATAGAAAAATTCAACGGCCGTAATTCAAATGCATTACAGTGGATCAAAGATTTTAATAAAGAATGTGAACGTTTTCAAATAAACGAGGATAAACAAAAAATTGAAATTTTGAAGAACTTCTTAGAAAATGCTAGTGTAGATTGGTACAGTTGTATGCTGATGAAGCTTACAGTACAATCAGAATGGAGCAAATGGGAGAAAAAATTTTGTGAGACATTTGCGAACAAAGGATGGTCCTCCACTAGATATGCTCTTGCCTTTAAATATCAATCGGGATCCTTACTTGAGTATGCTTTAAAGAAGGAGAAATTATTGTTGGAAGTCAGGAAGACAGTGGATACCGGAACAATTATTGATCTCATAGCATTTGGTTTACCCAATTATGTGGCGGACAAGATTGACAAAGAAACATTACAAAGAACGGAAGACCTTTACAATGAGATAAGAAAATTGGAACATCTGGTGATGAAAAATAAATATGAAAAAAGGAACAGCTCATATAATTTAGATAATAAAGGGAAAAATATTGACGAAAAGAAACCATGCCCAATCTGTTTAAATGAGAAAAAAGGGAAACGGTTCCACCCAGAAGACAGCTGTTGGTTCAAAGAAAAAAATAAAAAAGCTGTGGTTTCTGGAATCTATGACTCTGGATCTAATGTTTCTTTAATTAATGCAAGATTATTGAAAATACAAGAGAAACAGAAGACAAATGATATGCAAGTTGTAAACTTAAAAACTATTAATGGTGAGAAAAAAACGAAAGGTATGGTAACGCTAAAAATAAAAATCTACAATATTGAAAGAAATATGGATATTTTTGTGGTGGATAATGAAAATTTTAACTATGACTTCTTAATTGGTTTGGATTGTATAAAAAAATTCAAATTAATACAAAATGAAGAACTTAACATCATACAATATCCCGAAAAGAAAAGCATAATCTCAAATGAACATTGTTTTAATGAGAATAATTTAACAAATGTCGGAATTCCTGATGTACTAGGTGACAAAAATAAAGAACAAACATTTAAAAAGAGAATAGAAGAGAAAGAGAAGATAGAGATGGAACTATACTCTGAGATAGTAAAAAAGGGTACTACTATAAATACCAACAAATTGTGTGAAATTAATTTCAATGAACATGTACACATTGATGAATTTCAAATGTCTGTAAATCATCTAGATTTATATCAGCAATCAAAAATTGAGAAGTTAGTAGATAAATACAAATCTGTTTTTGCTAAGGACAAATATGATGTTGGCTCTGTGCAGGATTATGAAGCCCATATAGACTTGATGGTAGATAAATACTGCTATAAGCGTCCGTACAGATGCACAATTGAAGACAGAACAGAAATTGAAAGTCAAATATCGAAGCTACTACAGAAAAATTTGATAGAGGAATCTTACAGCCCGTTTGCTGCTCCTGTAACTCTAGCATATAAGAAAGAAGATGATAAAAAAACAAGATTATGCATAGATTTCAGAGATTTAAACAAAATAGTAGTTCCACAATCACAACCTTTCCCACTTATAGAGGACTTAATGACCAAAACAGTAAACTGTAAGTATTATTCTACATTAGACATAAACTCAGCATTTTGGTCGATCCCATTGAAAATTCAAGATAGACATAAGACTGCTTTTGTGACACAAGAAGGACATTTTCAATGGACTTGTCTCCCATTTGGGTTAAAGACTGCACCAGCAATTTTCCAAAGAATATTGAGCAATATTATAAGAAAACACAGACTATCTAACTTTGCAGTAAACTTTATTGACGACATCTTAATTTTTTCTAAAACTTTTGAGGAACATATACAACACATATCGAGACTACTGGAAGCAATACAAAAGGAAGGGTTTAGACTGAAGTTTTCAAAATGTACATTTGCAAGTCACCATGCTAAATACTTGGGTCATATAATAGAAAACAATTCAGTTAGACCTCTGAAAGATTATTTAACTGCTGTCAAAAGCTTCCCAATTCCAGAAACAAGGAAAAATATACGGCAGTTTTTGGGAAAAGTAAATTTTCATCATAAGTTTGTACCACATAGTGCAATTATCCTCGATCCATTACATAACTTATTAAGAAAAGATGTGAAATTTGTATGGACGGCAGAATGCCAGGAAGCATTTGATAAAATTAGAGCATTGCTTTGCTCAGAACCAATCCTAAAAATATTTGACCCAGATTCACCGATAAGAATTTACACAGATGCTAGTATCAAAGGAGTTGGAGCAGTGTTGAAACAAGACGATGAAAACGGCGTGAGTAAACCGGTTGCTTATTTTTCGAAGAAATTAACAGAAGCACAGAAAAAGAAGAAGGCAATATACTTAGAATGTCTGGCGATAAAAGAAGCAGTCAAATACTGGCAACATTGGCTTATGGGAAAAGAATTTATGGTATACACAGATCATAAACCCCTGGAAAATATGAACATTAAAGCTCGAACTGATGAGGAACTAGCCAAAAATATTACAGCAAACATTAATAAAATGTGTGATGCGTGTGAAACCTGCATTAAAAACAAGTCCAGGAGGAAGTCGAAATATGGTTTAATGTCACATTTGGGACCAGCCACACACCCGTTTGAAATTGTATCCATCGATACTATTGGGGGCTTTGGAGGATCCCGATCAACCAAAAGCGAAGGTGTCCCGTCTGTCGCGCTCACGTTCAGCACGCGGGAGTCGGCTCGGATGTCGTTCAGATCGCAGGCGAGACTCACCACGCCCGTGCTCGAATCCAACGAGAAGCAATTATCATCATTGCCGCCGACGATTCGATAA
Protein
MEKLRFDFAMKSMADGKTNVICITSIATPSGQVFGIPVEYQPVNLHKVITTTPNYTRVKNSLVKTHQTRKIWITVTEEISKTYLDEEQNLQFNDCYLEEISEQPVSYESTSSDSNHMLEKLLEKLQEQKQQKPEKQNLGKIAKDFIIEKFNGRNSNALQWIKDFNKECERFQINEDKQKIEILKNFLENASVDWYSCMLMKLTVQSEWSKWEKKFCETFANKGWSSTRYALAFKYQSGSLLEYALKKEKLLLEVRKTVDTGTIIDLIAFGLPNYVADKIDKETLQRTEDLYNEIRKLEHLVMKNKYEKRNSSYNLDNKGKNIDEKKPCPICLNEKKGKRFHPEDSCWFKEKNKKAVVSGIYDSGSNVSLINARLLKIQEKQKTNDMQVVNLKTINGEKKTKGMVTLKIKIYNIERNMDIFVVDNENFNYDFLIGLDCIKKFKLIQNEELNIIQYPEKKSIISNEHCFNENNLTNVGIPDVLGDKNKEQTFKKRIEEKEKIEMELYSEIVKKGTTINTNKLCEINFNEHVHIDEFQMSVNHLDLYQQSKIEKLVDKYKSVFAKDKYDVGSVQDYEAHIDLMVDKYCYKRPYRCTIEDRTEIESQISKLLQKNLIEESYSPFAAPVTLAYKKEDDKKTRLCIDFRDLNKIVVPQSQPFPLIEDLMTKTVNCKYYSTLDINSAFWSIPLKIQDRHKTAFVTQEGHFQWTCLPFGLKTAPAIFQRILSNIIRKHRLSNFAVNFIDDILIFSKTFEEHIQHISRLLEAIQKEGFRLKFSKCTFASHHAKYLGHIIENNSVRPLKDYLTAVKSFPIPETRKNIRQFLGKVNFHHKFVPHSAIILDPLHNLLRKDVKFVWTAECQEAFDKIRALLCSEPILKIFDPDSPIRIYTDASIKGVGAVLKQDDENGVSKPVAYFSKKLTEAQKKKKAIYLECLAIKEAVKYWQHWLMGKEFMVYTDHKPLENMNIKARTDEELAKNITANINKMCDACETCIKNKSRRKSKYGLMSHLGPATHPFEIVSIDTIGGFGGSRSTKSEGVPSVALTFSTRESARMSFRSQARLTTPVLESNEKQLSSLPPTIR

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00078   RVT_1
Interpro
IPR041577   RT_RNaseH_2        + More
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
SUPFAM
SSF53098   SSF53098       
Gene 3D
PDB
4OL8     E-value=2.18258e-67,     Score=653

Ontologies

Topology

Length:
1079
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.25361
Exp number, first 60 AAs:
0.25168
Total prob of N-in:
0.01254
outside
1  -  1079
 
 

Population Genetic Test Statistics

Pi
10.999681
Theta
10.461729
Tajima's D
-1.384835
CLR
0.938055
CSRT
0.072346382680866
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号