SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16492  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004585
Annotation
vitellogenin_precursor_[Bombyx_mori]
Full name
Vitellogenin      
Location in the cell
Nuclear   Reliability : 3.302
 

Sequence

CDS
ATGAAGCTATTCGTCTTGGCGGCAATTATAGCCGCCGTGTCCTCGGATCGGTTTAGCAGCCAGAGCCAGTCCACAGGCGGACAAACATATCCATCACCTTGGCAGGTTGGCAAACAATACCGGTATGAGGTCACTTCTCGCACTTTGGCGCATTTGCAGGAGGGTCCAAGCAGCGGAAGCGCTTTCAAAGCACAATTCACAATCCGGGTAAAGAGTCCTGGCCGACTCCAAGCGAAACTAGAGAATCCACAGCATGGTAACTTCAATGAGCAACTCCCTGACCCGAGGGAACTGCCTGTTGATCTCAAGTACCAACCTACGCCGAACATCGATAAGGTATTCGAAATTGAAATTGACGGAGGTCGAATCGTAAGCCTCGATTTTCCAACTTCAGTTCCTGTCCCCCAAGAGAATTTAATAAAGGGTCTTATCAGCGCTCTGCAACTTGACACGTCGGCTCACAGAATCATTCACGACTCTCAAAACAACTACGACAGAGAACAGCAACAGGGCCTTTTCAGGAAAATGGAGACTGATGTGACTGGTGATTGTGAGACGCTGTACACGGTATCTCCTGTTGCTTCAGAATGGCGGCGAGAGCTTCCGAAGTTCGCTAACGAACAGGACCCTGTTGAGGTTACAAAGAGCACAAATTACGGTCACTGTCACCACCGGGTCGCTTATCACTTCGGAGTGCCGGTCGGTGCTGAGTGGACTGGAACAGCGCACAAAACCCAAGAACAACAGCTCATTGGCCGCGCTACTTACTCCCGTATCTTAACAGGCAAAGAGGGACCTATTTACAAAGCTGAAACCACGAGCACCGTTCATGTCCACCCTCATCTTTATGGTAAACAGAAAGCCGAAGTATACAGTCACGTCCATATGGAACTGATTTCAGTAGATCAAGACAGTGGGGCTGAATGGCCGAGAGCTGAAGCGATGCGTCCTGCTCAAAGCATTTTATATTCCTTAAGCACAAAACAAATGACTAAGCATTACGAGTCTTCTTCGTCATCGTCTTCTTCGGAATCTCACGAATTCAATTTCCCAGAGCAACACGAACACCCGCATCAGTCCAATCAACGATCGCGTCGTTCTTACATGAGATCTAAATTGGTGACTGTTCACAAAGTACTCAAAAAACGCAACAGCGAAAGCTCGTCTGGTTCTTCAAGTTCAAGTGCGGATTCATCTTCAGCGTACATTAATGATGACATCCCGGACATTGATGAGCCGGCGTATGCAGCATTATATATGAGCCCTCAACCTCACGCGGACAAAAAGCAGAATGCAATGAACGCACAAAAGATTCTTCAAGACATTGCACAACAGTTGCAAAATCCTAATAATATGCCTAAATCTGATTTCCTATCCAAATTTAATATCCTCGTTCGACTTATCGCCAGTATGAGCACCGAACAGCTCAGCCAAACTAGTAGAAGCATTGAAACTGCGAAGACTTCGAACAATATCATTAAATCTGACATGTGGATGATATTCCGTGATGGTGTCACTCAAGCTGGTACGTTGCCAGCTTTCAAACAAATTCAGTCTTGGATTGAGAACAAAAAAATCCAAGAGGAAGAAGCTGCACAAGTAGTCGCTGCTTTGCCTAGGACCCTACGCTACCCCACTAAGCAAATTATGACACAGTTCTTCAATTTTGCCAGAAGTCCTGCAGTCAAAGATCAAATGTTCCTCAATTCGAGTGCCCTGATGGCTGCCACAAAATTGATAAATTTGGGCCAAGTTAATAACTATACCGCTCACTCTTATTATCCGACACACATGTATGGTCGCCTTACGCACAAACATGACGCTTTTGTTCTCGAAGAAATTTTGCCTACTCTAGCAGCGGACTTGAAAGCATCCGTTGAATATAAAGATAGTACGAAAGCTCAAGTTTACATTCAAGCTATTGGTAATTTGGGTCATCGCGAAATACTCAAAGTCTTCGCTCCATATTTGGAAGGAAAAGTTGAAATATCTACTTATCTTCGCACTCATATTGTGAAGAATTTAAAATCTTTGGCTAAGCTAAGAGATCGGCATGTACGTGCTGTCCTGTTTAGCATTTTAAGAAACACGGCTGAGCCATATCCTGTTAGAGTTGCAGCGATCCAGAGTATATTCATAAGCCACCCCACCGGAGAAATGATGCAAGCTATGGCTGAAATGACCCACAACGATCCAAGTGTAGAAGTTCGGGCTGTTCTTAAGTCCGCCATTTTATCAGCTGCTGAATTACAACACCCACGCAATTTTTATCTATCTAGAACGGCTCAAGCTGCTAGATACTTGGTTACAAATGAAGAATTTGGTTACCAGCATTCATTTAAGTTTATTGATGATAGCTACGACGAAGATAATGACATTGGGACTTTCGTTATTTCCCACATCGGTAGCGAGGATAGTCTTCTGCCAAAAGATTTTAAAATCGTCACCAATTCCAAGGGAGGAGCCTGGGAAAGAAACACAATTGAAGCATCATTCTCTAGTGCTGAACGTTTCTTAGACTACTTAAGGGACTCGGTATTCGCACCTCACCCTAAATTCGATAGAGCTCACAAATATTCCGCTGAGAAAATCGCTAAGCTCTTAAATATAAAGAATGATGAGGAAGAGCCTTTAGAAGCATCTTTTTATGTCGATTTCATGAACAACCAGAGATTATTCAGTTTCAGCGAATCCGACCTACAGCAGTTGTCCCAATATATTAGCGAATACATGAAAAAAGTAGAGAGTGGCGCTGAAAAGCATTACACAAAAGTTTATAACCAGGATCAAGTTTCAATAATGTTCCCAGTAGCATCTGGTATGCCATTCATCTTTAAATATAAAGAACCGGCTGTGATTCATTTCCAAAGCAAACTCAAAGGGAAATTTTCATTCCCGTCAAAGGATAACAAATACTACGAGGCAAACATGATTAAAGACGTGCAATTCACATACGCCAGGAATATTGACGGAAACGTTGGCTTTATGGATACCCTTAGCAACCAATATTCCAGTGTAGGTGTTGTGAATAAACTCCAATTTAACATACCGTTCAAATTCGGAATCGAAATTAAATCTGGACTAATAAAGTTCAGAGTCGAACCTCTGCATCCAGACCAGGATCAGACCTTAGTTCACTATAGTGTTTGGCCGTACAGTGCCAGCCAAAAGAAGGATTCCCTTGTTGCAATCTCTCAAGACCCAGCTACTAAAATTGTCGAACGTAGAAGCAAGGTATTTTCAGTAGACTCTAAGTACGGTCAATCCACACATGCCGTAATCTACGCGCAAGGATACACATACTCTTCCGACTGGAGGAACTTTGGCGCTAAGTTTACTTCCCGTGACTATTTTACCAACTTAGCGTCACTACTGACACAGGAGGATATCGCTCTGACCCACTTCAACTTAAAACACCTTTGCAAACAATCACAGAGTAAGGCTTTGACCATTACCGCTTATTATGATGAATACTACAACCAACAGAACAGCGGTATATTAACAGACGCTACTGATCGCAACGACCTCAGTCCGAACAGCGAAACACGTCGAGCCGAAATGGTGAAACTAGTTTCTGCTGGCATTAACAAAGCTAGAGTGAGAGTTGTGGATTTGAGTGCTAGCTTTGAGGGCAGTCAAGATCAGAATTACGTTTTCACTGGCACCTGGGGTGATAGTCCGGTCGATTCAAAGGTTCAAGGAATGTTATTTGCTGGCACAAAGTCTGCAACGCAAGGAAACCAACAAATAAACGCTGTATTTGCCACTACGAAGCCGGAGATTCATTCCCTAAGCTTTTCGAAGGCTTTACAGAGCGATTTGAGGGCTCCTTTCGGAATGCACTTCAAGTACGGCCAGAGTGGAGAGATCCGTGTCTCTGGAAGCTTCGATCGTACCAAAAAATATACAACTGAACTAGAAAATCATCCTCTCGCCAAGCAATGCTCTCAACAAACCACCCTCAATAACTTCTACCAAGATTCTTGTCACAAAGCTATCGTTATGGCTCATGCGCCTGATCATGTGGAATTCTCCGTCTCATTCCAAGACATGAGTCCTCAATACAGAAACTTCTCCTACCACACATACAGACTCTATGAGTACTTGGGTTACTGGTATACTGAAGCTAATCCTTTGAAACTAACTCAAAATGGTAAAATGGACTTCAAAATTGATTTCTCGTACTTCGATCGTACTTACACCGTCGATATTGCATCCCCATCTGGAGAGGCACGAATGAGGGACATGCCAATTGCAACAATGGCACCTGGTGCTTTGTCTTTCTACCAACCGCTAAAAGCTTATGAACTCGTTGCCAATTACTTCACTGGCCACCAATATCAACCCTACTGTTCTATCGATGGCACAAGGATACATACCTTCAGTAATCGCAGCTACGAATATCCCCTATCTCGATCCTGGCACGTAGTCATGCAGGACGAGTCTACTCAACGCGGCAACTGGCACGAGTTGGCTATCTTGTCCAGGAGGCAACAGAGAGATCAACAGGAGATCTATATTTCTTACAAGTCTGAGTCAGGACAGGATCTTGAGATCGAAATACAACCAGCGTCTGGAGACTCTGCATATCAAGTGAAAGTCACGACGAATACCAAGAAGATCACCGATGATGACCTCACCATGTACTGGGATGATGTCAAGGAGCAACCGTTCTTACAATACCACACCCACAAAGACGGCGTTCTGGTCATAAATATAGAAGACGACAGGATCAGAGCTATATATGACGGCCAGAGATTTGTCGTTTTCACACAGGACTATCGTAATTCGACCAGAGGCATCTGTGGACGTATGAGCGGCGAGCAGCGCGACGACTATCTCACTCCAGAAGGTTTGGTCGACAAGCCTGAGCTATATGCCGCAGCCTACAGCCTAAATGAGGAGAACAGTGACCCCAAAACCCAGGAACTGAAGGCTCTAGCAACACAACAAGCTTACTACCCAGAATATAAGTACACAAGCATCCTACGCTCTGACCCAACTTGGCAAGAAGAATCACAGTCCTCCGGTGAGGATCAATGGCAGTCTGAAACCGTCTATAAGTCTAGAAGCTACGACAAACACAAGGGCGCTTGTGAAGTTAGGCAACAGGTGCAGTTTTATGAGAACCACGGCGATATCTGTATCACAACTTCGAGAGTCCCCTCGTGTCAGTCGCATTGCCGTGCTGGAGACTACAAAATACAGCACGTTCAAGTGACGTGTAAATCGAAACTCGACCACGACTTCCGCATGTACAAAGAACAGATCAAAAAGGGCCAGAACCCCGAGGTATCTGGAATACCTAGCGTCAAGCAATTCAAAGTACCGGTAACTTGCCAGCCTTAA
Protein
MKLFVLAAIIAAVSSDRFSSQSQSTGGQTYPSPWQVGKQYRYEVTSRTLAHLQEGPSSGSAFKAQFTIRVKSPGRLQAKLENPQHGNFNEQLPDPRELPVDLKYQPTPNIDKVFEIEIDGGRIVSLDFPTSVPVPQENLIKGLISALQLDTSAHRIIHDSQNNYDREQQQGLFRKMETDVTGDCETLYTVSPVASEWRRELPKFANEQDPVEVTKSTNYGHCHHRVAYHFGVPVGAEWTGTAHKTQEQQLIGRATYSRILTGKEGPIYKAETTSTVHVHPHLYGKQKAEVYSHVHMELISVDQDSGAEWPRAEAMRPAQSILYSLSTKQMTKHYESSSSSSSSESHEFNFPEQHEHPHQSNQRSRRSYMRSKLVTVHKVLKKRNSESSSGSSSSSADSSSAYINDDIPDIDEPAYAALYMSPQPHADKKQNAMNAQKILQDIAQQLQNPNNMPKSDFLSKFNILVRLIASMSTEQLSQTSRSIETAKTSNNIIKSDMWMIFRDGVTQAGTLPAFKQIQSWIENKKIQEEEAAQVVAALPRTLRYPTKQIMTQFFNFARSPAVKDQMFLNSSALMAATKLINLGQVNNYTAHSYYPTHMYGRLTHKHDAFVLEEILPTLAADLKASVEYKDSTKAQVYIQAIGNLGHREILKVFAPYLEGKVEISTYLRTHIVKNLKSLAKLRDRHVRAVLFSILRNTAEPYPVRVAAIQSIFISHPTGEMMQAMAEMTHNDPSVEVRAVLKSAILSAAELQHPRNFYLSRTAQAARYLVTNEEFGYQHSFKFIDDSYDEDNDIGTFVISHIGSEDSLLPKDFKIVTNSKGGAWERNTIEASFSSAERFLDYLRDSVFAPHPKFDRAHKYSAEKIAKLLNIKNDEEEPLEASFYVDFMNNQRLFSFSESDLQQLSQYISEYMKKVESGAEKHYTKVYNQDQVSIMFPVASGMPFIFKYKEPAVIHFQSKLKGKFSFPSKDNKYYEANMIKDVQFTYARNIDGNVGFMDTLSNQYSSVGVVNKLQFNIPFKFGIEIKSGLIKFRVEPLHPDQDQTLVHYSVWPYSASQKKDSLVAISQDPATKIVERRSKVFSVDSKYGQSTHAVIYAQGYTYSSDWRNFGAKFTSRDYFTNLASLLTQEDIALTHFNLKHLCKQSQSKALTITAYYDEYYNQQNSGILTDATDRNDLSPNSETRRAEMVKLVSAGINKARVRVVDLSASFEGSQDQNYVFTGTWGDSPVDSKVQGMLFAGTKSATQGNQQINAVFATTKPEIHSLSFSKALQSDLRAPFGMHFKYGQSGEIRVSGSFDRTKKYTTELENHPLAKQCSQQTTLNNFYQDSCHKAIVMAHAPDHVEFSVSFQDMSPQYRNFSYHTYRLYEYLGYWYTEANPLKLTQNGKMDFKIDFSYFDRTYTVDIASPSGEARMRDMPIATMAPGALSFYQPLKAYELVANYFTGHQYQPYCSIDGTRIHTFSNRSYEYPLSRSWHVVMQDESTQRGNWHELAILSRRQQRDQQEIYISYKSESGQDLEIEIQPASGDSAYQVKVTTNTKKITDDDLTMYWDDVKEQPFLQYHTHKDGVLVINIEDDRIRAIYDGQRFVVFTQDYRNSTRGICGRMSGEQRDDYLTPEGLVDKPELYAAAYSLNEENSDPKTQELKALATQQAYYPEYKYTSILRSDPTWQEESQSSGEDQWQSETVYKSRSYDKHKGACEVRQQVQFYENHGDICITTSRVPSCQSHCRAGDYKIQHVQVTCKSKLDHDFRMYKEQIKKGQNPEVSGIPSVKQFKVPVTCQP

Summary

Subunit
Heterotetramer of two heavy and two light chains.
Keywords
Cleavage on pair of basic residues   Complete proteome   Direct protein sequencing   Glycoprotein   Phosphoprotein   Reference proteome   Secreted   Signal   Storage protein  
Feature
chain  Vitellogenin
EMBL
BABH01025711    D13160    D30733    AB239763    BAE47146.1    AB055845    + More
BAB32642.2    GU361974    ADB94560.1    EF523567    ABP63663.1    AB190810    BAD91196.1    AB055844    BAB32641.1    EF683091    AB049631    ABS19573.1    BAB16412.1    AB247378    BAF45319.1    AB055843    BAB32640.1    AB190809    BAD91195.1    JTDY01000218    KOB78233.1    KZ150067    PZC74123.1    JX504706    AGL08685.1    NWSH01001771    PCG70188.1    JQ723600    AFV40972.1    KQ458842    KPJ04900.1    KF501044    AHG29547.1    KQ459890    KPJ19580.1    KT947112    ALN38805.1    JN408698    AEM75020.1    ODYU01011461    SOQ57205.1    KT599434    AOH73254.1    EU095334    ABU68426.1    KT274176    ALR35190.1    KJ540279    AHZ89334.1    MG799570    AXY55008.1    RSAL01000078    RVE48729.1    AGBW02012867    OWR44310.1    KT724958    AMD78107.1    U60186    AAB03336.1    U90756    AAC02818.1    MH553377    AXM43802.1    NWSH01004650    PCG64818.1    NWSH01003613    PCG66057.1    ODYU01007081    SOQ49535.1    PZC74124.1    PCG70190.1    PZC74126.1    PZC74125.1    MF622538    AWJ95280.1    ODYU01003950    SOQ43336.1    CVRI01000037    CRK93348.1    DS235849    EEB18660.1    AB007850    BAA22791.1    EEB18658.1    AF281078    AAF82131.1    AAAB01008880    EAA08615.3    JN113091    AEO51020.1    AY691326    AAV31932.1    DQ442990    ABD97990.1    KJ000491    AHN13887.1    GGFM01000032    MBW20783.1    KF577805    AGZ02020.1    GGFJ01000131    MBW49272.1    GGFJ01000130    MBW49271.1    GGFK01000087    MBW33408.1    NNAY01002208    OXU21803.1    KJ000061    AHM10344.1    GGFM01000045    MBW20796.1    GGFJ01000129    MBW49270.1    ADMH02000727    ETN65235.1    AY691327    AAV31933.1    GGFK01000066    MBW33387.1    GGFK01000069    MBW33390.1    GAMD01002962    JAA98628.1    EF468683    ABO70318.1    KX752432    AQM52239.1    UFQT01000300    SSX22992.1    JQ867181    AFW97644.1    JXUM01034631    KQ561030    KXJ79966.1    GFDF01007630    JAV06454.1    GFDF01007631    JAV06453.1    KF113336    AGV05363.1    AB425334    BAG12118.1    GU017909    ADH04224.1    AY373377    AAQ92366.1    KJ652904    AJI43739.1    CH477376    EAT42292.1    KC136271    AGT39945.1    JXUM01057208    KQ561944    KXJ77091.1    GU017910    ADH04225.1    GEDC01030487    GEDC01029876    JAS06811.1    JAS07422.1    LC115022    BAU36889.1    GGFM01000031    MBW20782.1    GEDC01031612    JAS05686.1    GGFL01006214    MBW70392.1    ACPB03007241   
Pfam
PF01347   Vitellogenin_N        + More
PF09172   DUF1943
PF00094   VWD
PF00096   zf-C2H2
Interpro
IPR001747   Lipid_transpt_N        + More
IPR015255   Vitellinogen_open_b-sht       
IPR015816   Vitellinogen_b-sht_N       
IPR015819   Lipid_transp_b-sht_shell       
IPR001846   VWF_type-D       
IPR011030   Lipovitellin_superhlx_dom       
IPR036236   Znf_C2H2_sf       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF48431   SSF48431        + More
SSF56968   SSF56968       
SSF57667   SSF57667       
Gene 3D
PDB
1LSH     E-value=2.1116e-05,     Score=121

Ontologies

Topology

Subcellular location
Secreted  
SignalP
Position:   1 - 15,         Likelihood:  0.991085
 
 
Length:
1782
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00167
Exp number, first 60 AAs:
0.00144
Total prob of N-in:
0.00008
outside
1  -  1782
 
 

Population Genetic Test Statistics

Pi
11.298257
Theta
17.506995
Tajima's D
-1.073127
CLR
0
CSRT
0.125943702814859
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
31223520 FIDDSYDEDNDIGTFVISHIGSEDSLLPK 100.00 3e-16
31223520 FRVEPLHPDQDQTLVHYSVWPYSASQK 100.00 1e-13
31223520 FRVEPLHPDQDQTLVHYSVWPYSASQK 100.00 1e-13
31223520 LYEYLGYWYTEANPLK 100.00 1e-13
31223520 AIVMAHAPDHVEFSVSFQDMSPQYR 100.00 6e-13
31223520 AYELVANYFTGHQYQPYCSIDGTR 100.00 6e-13
31223520 AYELVANYFTGHQYQPYCSIDGTR 100.00 6e-13
31223520 KMETDVTGDCETLYTVSPVASEWRR 100.00 7e-12
31223520 KMETDVTGDCETLYTVSPVASEWR 100.00 1e-11
31223520 KMETDVTGDCETLYTVSPVASEWR 100.00 1e-11
31223520 VYNQDQVSIMFPVASGMPFIFK 100.00 4e-11
31223520 LFSFSESDLQQLSQYISEYMKK 100.00 4e-11
31223520 VYNQDQVSIMFPVASGMPFIFK 100.00 4e-11
31223520 AEVYSHVHMELISVDQDSGAEWPR 100.00 7e-11
31223520 AEVYSHVHMELISVDQDSGAEWPR 100.00 7e-11
31223520 METDVTGDCETLYTVSPVASEWR 100.00 7e-11
31223520 AYELVANYFTGHQYQPYCSIDGTR 100.00 7e-11
25044914 AYEAIYCIAVR 95.83 9e-11
29197581 KGQNPEVSGIPSVK 95.83 2e-10
31223520 VIHDSQNNYDREQQQGLFR 100.00 2e-10
31223520 VIHDSQNNYDREQQQGLFR 100.00 2e-10
31223520 EGPIYKAETTSTVHVHPHLYGK 100.00 2e-10
31223520 EGPIYKAETTSTVHVHPHLYGK 100.00 4e-10
31223520 METDVTGDCETLYTVSPVASEWR 100.00 4e-10
24093152 MEFEITDAR 95.65 5e-10
29197581 NDISPNSETR 95.83 9e-10
31223520 KMETDVTGDCETLYTVSPVASEWR 100.00 1e-09
31223520 YGQSTHAVIYAQGYTYSSDWR 100.00 9e-09
31223520 LTHKHDAFVLEEILPTLAADLK 100.00 9e-09
31223520 LTHKHDAFVLEEILPTLAADLK 100.00 9e-09
20822545 IIHDSQNNYDREQQQGLFR 100.00 1e-08
31223520 MRDMPIATMAPGALSFYQPLK 100.00 2e-08
31223520 VIHDSQNNYDREQQQGLFR 100.00 2e-08
31223520 DMPIATMAPGALSFYQPLK 100.00 2e-08
31223520 DMPIATMAPGALSFYQPLK 100.00 2e-08
31223520 DMPIATMAPGALSFYQPLK 100.00 2e-08
31223520 VIHDSQNNYDREQQQGLFR 100.00 2e-08
31223520 YGQSTHAVIYAQGYTYSSDWR 100.00 3e-08
31223520 YGQSTHAVIYAQGYTYSSDWR 100.00 3e-08
31223520 MRDMPIATMAPGALSFYQPLK 100.00 3e-08
31223520 MRDMPIATMAPGALSFYQPLK 100.00 3e-08
31223520 MRDMPIATMAPGALSFYQPLK 100.00 3e-08
20822545 LENPQHGNFNEQLPDPR 100.00 5e-08
31223520 LENPQHGNFNEQLPDPR 100.00 5e-08
31223520 LENPQHGNFNEQLPDPR 100.00 5e-08
31223520 LENPQHGNFNEQLPDPR 100.00 5e-08
31223520 LENPQHGNFNEQLPDPR 100.00 5e-08
31223520 LENPQHGNFNEQLPDPR 100.00 5e-08
26822097 IDFSYFDR 100.00 5e-08
24093152 VAVSTCHGVR 100.00 5e-08
31223520 SESGQDLEIEIQPASGDSAYQVK 100.00 5e-08
31223520 SESGQDLEIEIQPASGDSAYQVK 100.00 5e-08
31223520 SESGQDLEIEIQPASGDSAYQVK 100.00 5e-08
29197581 SAIISAAEIQHPR 95.65 7e-08
31223520 LFSFSESDLQQLSQYISEYMK 100.00 3e-07
31223520 IVSLDFPTSVPVPQENLIK 100.00 4e-07
31223520 VAYHFGVPVGAEWTGTAHK 100.00 4e-07
31223520 IVSLDFPTSVPVPQENLIK 100.00 4e-07
31223520 IVSLDFPTSVPVPQENLIK 100.00 4e-07
31223520 IVSLDFPTSVPVPQENLIK 100.00 4e-07
31223520 LYEYLGYWYTEANPLK 100.00 9e-07
31223520 LYEYLGYWYTEANPLK 100.00 9e-07
31223520 LYEYLGYWYTEANPLK 100.00 9e-07
31223520 ILQDIAQQLQNPNNMPK 100.00 9e-07
31223520 ILQDIAQQLQNPNNMPK 100.00 9e-07
31223520 ILQDIAQQLQNPNNMPK 100.00 9e-07
31223520 VYNQDQVSIMFPVASGMPFIFK 100.00 1e-06
20822545 YQPTPNIDKVFEIEIDGG 100.00 2e-06
20822545 IVSLDFPTSVPVPQENLIK 100.00 2e-06
20822545 VAYHFGVPVGAEWTGTAHK 100.00 4e-06
31223520 VAYHFGVPVGAEWTGTAHK 100.00 4e-06
31223520 VAYHFGVPVGAEWTGTAHK 100.00 4e-06
31223520 VAYHFGVPVGAEWTGTAHK 100.00 4e-06
31223520 VAYHFGVPVGAEWTGTAHK 100.00 4e-06
20822545 AEAMRPAQSILYSLSTK 100.00 1e-05
31223520 AETTSTVHVHPHLYGK 100.00 1e-05
31223520 ELPKFANEQDPVEVTK 100.00 1e-05
31223520 ELPKFANEQDPVEVTK 100.00 1e-05
31223520 ELPKFANEQDPVEVTK 100.00 1e-05
31223520 AETTSTVHVHPHLYGK 100.00 1e-05
31223520 ILQDIAQQLQNPNNMPK 100.00 1e-05
31223520 ILQDIAQQLQNPNNMPK 100.00 1e-05
31223520 ILQDIAQQLQNPNNMPK 100.00 1e-05
31223520 ILQDIAQQLQNPNNMPK 100.00 4e-05
31223520 HDAFVLEEILPTLAADLK 100.00 4e-05
31223520 HDAFVLEEILPTLAADLK 100.00 4e-05
31223520 HDAFVLEEILPTLAADLK 100.00 4e-05
31223520 YLVTNEEFGYQHSFK 100.00 2e-04
31223520 YLVTNEEFGYQHSFK 100.00 2e-04
31223520 YLVTNEEFGYQHSFK 100.00 2e-04
31223520 YLVTNEEFGYQHSFK 100.00 2e-04
31223520 YLVTNEEFGYQHSFK 100.00 2e-04
31223520 YLVTNEEFGYQHSFK 100.00 2e-04
31223520 YLVTNEEFGYQHSFK 100.00 2e-04
31223520 LIASMSTEQLSQTSR 100.00 5e-04
20822545 AETTSTVHVHPHLYGK 100.00 5e-04
20822545 KIQEEEAAQVVAALPR 100.00 7e-04
31223520 TLAHLQEGPSSGSAFK 100.00 7e-04
31223520 TLAHLQEGPSSGSAFK 100.00 7e-04
31223520 TLAHLQEGPSSGSAFK 100.00 7e-04
31223520 TLAHLQEGPSSGSAFK 100.00 7e-04
31223520 TLAHLQEGPSSGSAFK 100.00 7e-04
31223520 LIASMSTEQLSQTSR 100.00 0.001
31223520 FLDYLRDSVFAPHPK 100.00 0.001
31223520 LIASMSTEQLSQTSR 100.00 0.001
31223520 LIASMSTEQLSQTSR 100.00 0.001
31223520 LIASMSTEQLSQTSR 100.00 0.001
31223520 LIASMSTEQLSQTSR 100.00 0.001
31223520 LIASMSTEQLSQTSR 100.00 0.001
20822545 GLISALQLDTSAHR 100.00 0.001
31223520 GLISALQLDTSAHR 100.00 0.001
31223520 GLISALQLDTSAHR 100.00 0.001
31223520 GLISALQLDTSAHR 100.00 0.001
31223520 GLISALQLDTSAHR 100.00 0.001
31223520 GLISALQLDTSAHR 100.00 0.001
31223520 AETTSTVHVHPHLYGK 100.00 0.002
31223520 AETTSTVHVHPHLYGK 100.00 0.002
31223520 AETTSTVHVHPHLYGK 100.00 0.002
31223520 KDSLVAISQDPATK 100.00 0.005
31223520 KDSLVAISQDPATK 100.00 0.005
31223520 KDSLVAISQDPATK 100.00 0.005
31223520 TYTVDIASPSGEAR 100.00 0.005
31223520 TYTVDIASPSGEAR 100.00 0.005
31223520 TYTVDIASPSGEAR 100.00 0.005
31223520 YTTELENHPLAK 100.00 0.016
31223520 EQPFLQYHTHK 100.00 0.016
31223520 QIMTQFFNFAR 100.00 0.016
31223520 QIMTQFFNFAR 100.00 0.016
31223520 SAILSAAELQHPR 100.00 0.016
31223520 YTTELENHPLAK 100.00 0.016
26822097 IENPQHGNFNEQIPDPR 100.00 0.016
29197581 KDSIVAISQDPATK 100.00 0.016
31223520 ALATQQAYYPEYK 100.00 0.028
31223520 ALATQQAYYPEYK 100.00 0.028
31223520 ALATQQAYYPEYK 100.00 0.028
26822097 TQEQQIIGR 100.00 0.028
29197581 SESGQDIEIEIQPASGDSAYQVK 100.00 0.028
31223520 YKEPAVIHFQSK 100.00 0.049
31223520 YKEPAVIHFQSK 100.00 0.049
31223520 YKEPAVIHFQSK 100.00 0.049
31223520 YKEPAVIHFQSK 100.00 0.049
31223520 YKEPAVIHFQSK 100.00 0.049
31223520 YKEPAVIHFQSK 100.00 0.049
31223520 KGQNPEVSGIPSVK 100.00 0.049
26822097 QCSQQTTINNFYQDSCHK 100.00 0.049
24093152 TYSGGIIMTQEADGTIFPPQEGPHSNK 100.00 0.049
29197581 TQEQQIIGR 100.00 0.049
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号