SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16491  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005634
Annotation
PREDICTED:_protein_shuttle_craft_[Bombyx_mori]
Full name
Protein shuttle craft      
Transcription factor
Location in the cell
Extracellular   Reliability : 3.251
 

Sequence

CDS
ATGTGCAGCAGCAAGCTACCGCAAGTGTGCGGGCGTCCTTGCCAACGCATGCTACAGTGCGGCGTACACAAATGCATGAAGGAATGCCACGAGGGTCCCTGTGAAGACTGCACCGAGTCTGTTACACAAGTATGCCATTGCCCGCTGGCCAAGACTCGTGAGGTCGCGTGCCGCGTGGAGTCGTCGTGGTCGTGCGGCGGCGCGTGCGGGCGCGTGCTATCGTGCGGCGCGCACGTGTGCCGGAGCACGTGCCACGAGCCCCCCTGCCCCTCCTGCGACCTGCTGCCTGCCGCCCTCATCACATGTCCGTGCGGGAAGACTAGAATACCAAAAGACAAACGCAAGTCGTGCACGGATCCGATCCCGTTGTGCGGAAACATCTGCGCCAAGCCGCTGCCCTGCGGCCCGGCCGGTGACAAGCATTTCTGCAAACTAGACTGTCATGAAGGTCCTTGTCCCGTTTGTCCTGACAAGACCTTATTGCCGTGCCGCTGTGGTCATTCGAACCGCGAGGTTCCGTGCGCTGAGCTACCGGACATGTATAACAATGTGTTCTGTCAGAAGAAATGTAATAAGAAACTGTCGTGCGGTCGACACCGTTGCCGCGCGTGCTGCTGCGCGGACCCGCAGCACCGGTGCGGGCTCGTGTGCGGGCGCTCGCTCGCCTGCCAGACGCACCGCTGTCAGGACTTCTGCCACACCGGACACTGCGCGCCGTGCCCCACGCTCAGCTTCGAGGAGCTGAGCTGTACGTGCGGGCGCGAGGTGCTGCTGCCGCCCGTGCGCTGCGGCACGCGGCCCCCGCCCTGCAGCGCGCCGTGCCGCCGCGCGCGCCCCTGCGGGCACGAGCCGCTGCACTCGTGCCACACCGGGGACTGTCCGCCCTGCGTCGTGCTCACCACCAGGACCTGCCACGGCGGACACGAGGAACGAAAAACCATCCCGTGTTCGCAAGAAGAGTTCTCGTGCGGCCTCCCGTGCGGCAAACCTCTCCCTTGCGGTAAACATACCTGCATCAAGGTCTGTCACAAGGGACCTTGCGATGCCGGCAAGTGCACCCAGCCGTGCAACGAGAAGCGTGCGAGCTGCGGGCACCCGTGCGGCGCCGCGTGCCACTCCGGCGCGGCGGGCGGCGCGGGCGCGCTGTGCCCGAGCGCGGCGCCGTGCCGCCGCACCGTGCGCGCCACGTGCCCCTGCAAACGGAAATCAGCCGAGAGACCTTGCTTCGAAAACGCACGGGATTACGATAAAATGATGAGTGCTCTTGCCGCCACCAAGATTCAGGAGGGAGGCTCTGTTGACTTGTCCGACGCACAGCGCGCCGTCAATATGCTCAAAACGCTGGAGTGCGACGACGAGTGCCGCGTGGAGGCGCGCACGCGGCAGATGGCGCTGGCGCTGCAGATCCGCAACCCGGACGTGTCCGCCAAGCTGGCGCCGCGCTACAGCGAGCACGTGCGCGCCACCGCCCAGCGCGAGCCCGCCTTCGCCTACCACGTGCACAACCAGCTCACCGAGCTCGTGCACCTCGCCAAGAAGTCGAAACAGAAGACGCGCTCGCACTCTTTCCCGTCGATGAACAGACAGAAGCGGCAGTTCATCCACGAGCTGTGCGAGCACTTCGGCTGCGAGAGCGTGGCCTACGACGCGGAGCCCAACAGGAACGTGGTGGCCACTGCCGACAAGGAGAAGTCGTGGTTGCCGGCGATGAGCATAATGGAAGTGTTGTCGCGTGAGGCGGGCCGGCGGCGCGTGCCCGGCCCCGTGCTGCGGACCGCGCACTCCTCCGCCGCCTCTTCAGCCTCGACGACCTCCTCCTCCGCCGCTAACAAGTAA
Protein
MCSSKLPQVCGRPCQRMLQCGVHKCMKECHEGPCEDCTESVTQVCHCPLAKTREVACRVESSWSCGGACGRVLSCGAHVCRSTCHEPPCPSCDLLPAALITCPCGKTRIPKDKRKSCTDPIPLCGNICAKPLPCGPAGDKHFCKLDCHEGPCPVCPDKTLLPCRCGHSNREVPCAELPDMYNNVFCQKKCNKKLSCGRHRCRACCCADPQHRCGLVCGRSLACQTHRCQDFCHTGHCAPCPTLSFEELSCTCGREVLLPPVRCGTRPPPCSAPCRRARPCGHEPLHSCHTGDCPPCVVLTTRTCHGGHEERKTIPCSQEEFSCGLPCGKPLPCGKHTCIKVCHKGPCDAGKCTQPCNEKRASCGHPCGAACHSGAAGGAGALCPSAAPCRRTVRATCPCKRKSAERPCFENARDYDKMMSALAATKIQEGGSVDLSDAQRAVNMLKTLECDDECRVEARTRQMALALQIRNPDVSAKLAPRYSEHVRATAQREPAFAYHVHNQLTELVHLAKKSKQKTRSHSFPSMNRQKRQFIHELCEHFGCESVAYDAEPNRNVVATADKEKSWLPAMSIMEVLSREAGRRRVPGPVLRTAHSSAASSASTTSSSAANK

Summary

Similarity
Belongs to the NFX1 family.
Keywords
Alternative splicing   Complete proteome   DNA-binding   Metal-binding   Nucleus   Phosphoprotein   Reference proteome   Repeat   RNA-binding   Transcription   Transcription regulation   Zinc   Zinc-finger  
Feature
chain  Protein shuttle craft
splice variant  In isoform B.
EMBL
BABH01020191    BABH01020192    NWSH01000227    PCG78213.1    PCG78214.1    RSAL01000090    + More
RVE48091.1    ODYU01001380    SOQ37468.1    KQ459232    KPJ02641.1    KQ461155    KPJ08291.1    AGBW02013517    OWR43279.1    KC469893    AGC92703.2    FP102340    CBH09293.1    PYGN01000208    PSN51156.1    KQ971343    EFA04758.2    KYB27326.1    NEVH01014379    PNF27624.1    PNF27625.1    GECZ01027838    JAS41931.1    GECU01009311    GECU01006610    JAS98395.1    JAT01097.1    DS235093    EEB11835.1    GEBQ01027027    JAT12950.1    KZ288427    PBC25866.1    KK852714    KDR17911.1    GAMC01020057    GAMC01020055    JAB86498.1    KK107064    EZA60846.1    KQ978220    KYM96321.1    GEZM01096724    JAV54622.1    GL452364    EFN77337.1    GL888217    EGI64664.1    GALX01003148    JAB65318.1    KQ414614    KOC68840.1    JRES01000305    KNC32491.1    AJVK01033236    AJVK01033237    KQ981264    KYN44046.1    KQ434856    KZC08714.1    CH963913    EDW77484.2    CP012523    ALC39716.1    BT125955    ADX35934.1    GAKP01015839    JAC43113.1    GDKW01003695    JAI52900.1    GBXI01007360    JAD06932.1    GECL01001450    JAP04674.1    GFTR01008466    JAW07960.1    GBGD01000277    JAC88612.1    KA645427    AFP60056.1    GFDL01009011    JAV26034.1    CH902620    EDV31856.1    GFDL01009025    JAV26020.1    GFDL01009855    JAV25190.1    CM000157    EDW89773.1    GBHO01007718    GBHO01000278    JAG35886.1    JAG43326.1    CCAG010018380    GDHC01011747    JAQ06882.1    OUUW01000040    SPP89929.1    CH379058    EAL34416.2    CH954177    EDV58003.1    CH933807    EDW11771.1    CH479184    EDW37055.1    CH940649    EDW63647.1    ALC39723.1    JXJN01013499    AJWK01019755    SPP89928.1    AE014134    AGB92995.1    U09306    AF145679    KQ760869    OAD58748.1    AGB92996.1    DS231821    EDS44970.1    AXCM01000660    GDHF01018212    GDHF01005212    JAI34102.1    JAI47102.1    CM002910    KMY90342.1    KMY90343.1    CH477223    EAT47205.1    CH480818    EDW51806.1    ACPB03000855    GL732581    EFX74683.1    ADMH02000386    ETN66754.1    GGFK01006000    MBW39321.1    CH916368    EDW02849.1    GAPW01000154    JAC13444.1    GDIP01115026    JAL88688.1    GDIP01055985    JAM47730.1    CM000361    EDX05105.1    GDIP01074037    JAM29678.1    JXUM01028608    JXUM01028609    JXUM01028610    KQ560826    KXJ80724.1    GDIP01207964    JAJ15438.1    CH940650    EDW66643.2    GDIP01208014    JAJ15388.1    ATLV01014599    KE524975    KFB39190.1   
Pfam
PF01424   R3H        + More
PF01422   zf-NF-X1
Interpro
IPR034076   R3H_NF-X1        + More
IPR034078   NFX1_fam       
IPR001374   R3H_dom       
IPR019787   Znf_PHD-finger       
IPR036867   R3H_dom_sf       
IPR019786   Zinc_finger_PHD-type_CS       
IPR001841   Znf_RING       
IPR000967   Znf_NFX1       
SUPFAM
SSF82708   SSF82708       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
611
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00038
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00063
outside
1  -  611
 
 

Population Genetic Test Statistics

Pi
24.776219
Theta
36.513728
Tajima's D
-0.979608
CLR
0.012208
CSRT
0.140742962851857
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号