SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16489
Pre Gene Modal
BGIBMGA005568
Annotation
putative_NADH-ubiquinone_oxidoreductase_75_kDa_subunit?_mitochondrial_[Operophtera_brumata]
Location in the cell
Cytoplasmic   Reliability : 1.17 PlasmaMembrane   Reliability : 1.766
 

Sequence

CDS
ATGTTTAGATTTGCGAGAGAATCATTAACGAAGTTCCAGAAAAATCTTCAAAATGTTGTTAATAGGAGACAGTCAACGCAAGAAATTGATATATTCATTAATGGAAAACCCGTTAAGGTGCCCAGCTACTTCACAATATTACAAGCTTTACGTCGCGAGAAATTGACTGTGCCCACTTTTTGTTATCACGAACGTCTCTCCATTGCTGGTAACTGTAGAATGTGTTTGGTCGAATTAGAAGGCCTGTCAAAGTCACAGGTAGCTTGCGCCATGCCCGTGTCGAAGAACATGAAAATACGAACAAACTCCGCTAAAACCCAAACGGCTCAAGAAGGTGTACTAGAATTTCTACTTGTTAATCATCCATTAGATTGTCCTATTTGTGACCAAGGAGGTGAATGTGATTTGCAAGATCTATCGATGAGATTCGGCAATGACCGTTCAAGGTTTACTGACGTACATTTCGACGGAAAAAGAGCAGTCGAAGATAAAAATTTAGGGCCCTTAATACGAACAGAAATGACTCGTTGCATTCACTGTACTAGATGCATCAGGTTCGCTTCACAAGTTTGTGGCTTGGATGTTTTAGGTACTGCGGGGCGAGGCACTGAAATGCTTGTTGGTACTTATGTCGATAAGATGTTTTTATCTGAGTTATCTGGAAACATCATTGACTTGTGTCCTGTGGGAGCTTTAACATCGATGCCTTACATGTTCAAAGCAAGACCTTGGGAAGTACGGAGAACCAATTCCATTGACGTTACAGATGCAACCGGTACTAATATTGTAATAAATCATAGATTTGATCGTGTTTTAAGGATACTCCCTCGGGAGCACGATGAAATAAACCAAGAATGGCTTTCCGATAAAGGACGGTGGGCCATGGATTCACTTGAAATACAAAGATTAGTGACCCCTATGCTCAGAGTTGGTTCTTGTTTATGTCCTATCGAATGGAATTGTGCGTTGAAAACCGTTGCAGACTCGATAAATTGTACTTGTCCAGAAAATGTAATGGCTATTGCCGGTCCCCATTGTAATGTTGAAACTTTGGTAGCGGCCAAAGACTTTTTAAATATGTTAGGTTCAGAAAACACGTACGTCGAGCGCGGGATGTATTATACACAAACGGGAGCTGATATAAGAGCGGCGTATTCTTTAAATGTAAACATGAGGGATATAGCTCAAGCCGATATAATTTTACTAGTTGGAACCAACCCGAGATTCGAGGCTCCTATTTTGAATGCATGGATCCGACAAGCCTATATTACAAACGAGTGCGATATTTATGTAATAGGTCCTCGATGCGAGTTCAATTATTTTGTCAACTATTTAGGCGATGATATACAATCATTAAGTAAAGCTAGTGAAGTATTAAAAGAAGCTAAAAAACCACTTATTTTAGTTGGAATTTCACAACTGGAATCGGCATTTGGTGGGAAAATCATGAAAGAATTGACTAATATTGCAGCTTCATTTAAGGTAAACAATTGGTCAGTTTTGAATATTGTAACGCGAGAGGCTAGTTTTGCCGGTGCGTTAGAAGCTGGTTGGAAGCCGGGAGCTTTAGCAGCATTACAAGAAAAATGCCCAGATGTTTTGATATCATTGGGTGCTGATGAAATATTTTATAACTGGTCGCCACCACAGTCATGTAAACTTATTTATATAGGTTTTCAAGGTGATAAAGGTTCGGAGAATGCATCTATCGTTTTGCCGGGAAGTGCTTACACCGAAGCCGGTGGATTATATTTGAATATGGAGGGTAGATCTCAACACGCACTTCCTGCAGTCACACCGCCAGGGAAAGCGCGTCACGATTGGAAGATTATACGGGCTTTAGCGGAATATACTGGGATATGTTTGTTCTACAGCGATCACAGTTCTTTATCCTGTCGTCTGTCTCAAGTGAGCCCTAATTTCGTACATTTGGGAAAGTATCAGGATAAATTATTCAGTGACTTGATTGCCCCTCTTATTTGTTCGGATAGCAGTGCGAATGGTAAACTTAATGTCGACATGAAGACTCTGGTTGATTATTATTGTACCGATGTGTTTACTTACAACTCTACGACGATGATAAAGGCCCAGAAAGCTGCAGCAGAGCTTGCGAAATCTAGTTACGCTTGCGTGTAA
Protein
MFRFARESLTKFQKNLQNVVNRRQSTQEIDIFINGKPVKVPSYFTILQALRREKLTVPTFCYHERLSIAGNCRMCLVELEGLSKSQVACAMPVSKNMKIRTNSAKTQTAQEGVLEFLLVNHPLDCPICDQGGECDLQDLSMRFGNDRSRFTDVHFDGKRAVEDKNLGPLIRTEMTRCIHCTRCIRFASQVCGLDVLGTAGRGTEMLVGTYVDKMFLSELSGNIIDLCPVGALTSMPYMFKARPWEVRRTNSIDVTDATGTNIVINHRFDRVLRILPREHDEINQEWLSDKGRWAMDSLEIQRLVTPMLRVGSCLCPIEWNCALKTVADSINCTCPENVMAIAGPHCNVETLVAAKDFLNMLGSENTYVERGMYYTQTGADIRAAYSLNVNMRDIAQADIILLVGTNPRFEAPILNAWIRQAYITNECDIYVIGPRCEFNYFVNYLGDDIQSLSKASEVLKEAKKPLILVGISQLESAFGGKIMKELTNIAASFKVNNWSVLNIVTREASFAGALEAGWKPGALAALQEKCPDVLISLGADEIFYNWSPPQSCKLIYIGFQGDKGSENASIVLPGSAYTEAGGLYLNMEGRSQHALPAVTPPGKARHDWKIIRALAEYTGICLFYSDHSSLSCRLSQVSPNFVHLGKYQDKLFSDLIAPLICSDSSANGKLNVDMKTLVDYYCTDVFTYNSTTMIKAQKAAAELAKSSYACV

Summary

Similarity
Belongs to the complex I 75 kDa subunit family.
EMBL
BABH01020190    JTDY01010611    KOB58158.1    RSAL01000090    RVE48088.1    NWSH01000227    + More
PCG78211.1    KQ459232    KPJ02642.1    KQ461155    KPJ08290.1    ODYU01001380    SOQ37469.1    AGBW02009093    OWR51700.1    ODYU01008542    SOQ52237.1    KQ459562    KPI99867.1    KQ971357    EFA09221.1    GL732527    EFX87607.1    KZ149902    PZC78454.1    GDIP01184276    JAJ39126.1    NWSH01000489    PCG76048.1    GDIQ01060543    JAN34194.1    GDIP01029992    JAM73723.1    GDIP01252115    JAI71286.1    GDIQ01197951    JAK53774.1    GDIQ01256467    JAJ95257.1    BABH01012504    BABH01012505    BABH01012506    BABH01012507    APCN01000898    AAAB01008987    EAA00921.4    EGK97518.1    KZ288445    PBC25652.1    GDAI01002544    JAI15059.1    KQ414654    KOC65900.1    APGK01035707    BT128563    KB740928    AEE63520.1    ENN77918.1    KB632428    ERL95413.1    GFDF01001809    JAV12275.1    GFDF01001807    JAV12277.1    GDIQ01037043    JAN57694.1    ATLV01025119    KE525369    KFB52200.1    GL442815    EFN63001.1    GFDF01001808    JAV12276.1    LNIX01000003    OXA58105.1    GDHF01011491    GDHF01001581    JAI40823.1    JAI50733.1    GECL01002957    JAP03167.1    GDHF01022532    GDHF01018974    JAI29782.1    JAI33340.1    AXCM01002120    GAKP01007074    JAC51878.1    GEDC01000123    JAS37175.1    LRGB01001151    KZS13443.1    GDIP01069939    JAM33776.1    GEZM01003715    GEZM01003714    JAV96616.1    LBMM01003841    KMQ93064.1    GGFK01002495    MBW35816.1    AJVK01005738    AJVK01005739    AJVK01005740    AJVK01005741    AJVK01005742    AJVK01005743    AJVK01005744    AJVK01005745    GBXI01013652    JAD00640.1    KQ977513    KYN02174.1    GDKW01000637    JAI55958.1    KQ981701    KYN37487.1    LJIG01022746    KRT78931.1    NEVH01006983    PNF36272.1    KQ415854    KOG00068.1    GGFJ01002563    MBW51704.1    KQ982708    KYQ51794.1    AMQM01005159    KB096830    ESO01146.1    KQ979480    KYN21274.1    JR050215    AEY61202.1    AXCN02002451    GAMD01003432    JAA98158.1    ADMH02000836    ETN64916.1    GANO01001256    JAB58615.1    CH379065    EAL31512.2    CVRI01000020    CRK91262.1    GDIQ01250484    JAK01241.1    AHAT01034460    KQ976453    KYM85333.1    GANO01002580    JAB57291.1    GDIQ01213401    JAK38324.1    KQ435989    KOX67705.1    DS235088    EEB11658.1    GFTR01007854    JAW08572.1    GDRN01062949    JAI65029.1    KK107570    QOIP01000005    EZA48847.1    RLU23102.1    GL767674    EFZ13242.1    KQ434831    KZC07823.1    CCAG010012255    GGFM01000823    MBW21574.1    ACPB03005194    GAMC01017954    JAB88601.1    OUUW01000018    SPP89212.1    AAGJ04030728    AAGJ04030729   
Pfam
PF10588   NADH-G_4Fe-4S_3        + More
PF00384   Molybdopterin
PF09326   NADH_dhqG_C
PF14964   DUF4507
PF14639   YqgF
PF14641   HTH_44
PF14632   SPT6_acidic
PF14635   HHH_7
PF00575   S1
PF14633   SH2_2
Interpro
IPR036010   2Fe-2S_ferredoxin-like_sf        + More
IPR001041   2Fe-2S_ferredoxin-type       
IPR006656   Mopterin_OxRdtase       
IPR010228   NADH_UbQ_OxRdtase_Gsu       
IPR000283   NADH_UbQ_OxRdtase_75kDa_su_CS       
IPR019574   NADH_UbQ_OxRdtase_Gsu_4Fe4S-bd       
IPR006963   Mopterin_OxRdtase_4Fe-4S_dom       
IPR015405   NuoG_C       
IPR027844   DUF4507       
IPR003029   S1_domain       
IPR028083   Spt6_acidic_N_dom       
IPR028231   Spt6_YqgF       
IPR006641   YqgF/RNaseH-like_dom       
IPR022967   S1_dom       
IPR028088   Spt6_HTH_DNA-bd_dom       
IPR035018   Spt6_SH2_C       
IPR032706   Spt6_HHH       
IPR017072   TF_Spt6       
IPR012340   NA-bd_OB-fold       
IPR036860   SH2_dom_sf       
IPR035420   Spt6_SH2       
IPR035019   Spt6_SH2_N       
IPR012337   RNaseH-like_sf       
IPR000980   SH2       
IPR010994   RuvA_2-like       
SUPFAM
SSF54292   SSF54292        + More
SSF47781   SSF47781       
SSF53098   SSF53098       
SSF50249   SSF50249       
SSF55550   SSF55550       
Gene 3D
PDB
5XTI     E-value=0,     Score=1690

Ontologies

Topology

Length:
711
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0219899999999999
Exp number, first 60 AAs:
0.00311
Total prob of N-in:
0.00109
outside
1  -  711
 
 

Population Genetic Test Statistics

Pi
17.573289
Theta
31.67736
Tajima's D
-1.40232
CLR
0.145942
CSRT
0.0711964401779911
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号