SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16479
Pre Gene Modal
BGIBMGA002224
Annotation
PREDICTED:_uncharacterized_protein_LOC105383792_[Plutella_xylostella]
Location in the cell
PlasmaMembrane   Reliability : 1.315
 

Sequence

CDS
ATGGAGAAAATAAACTGCAGTTTGTTAGCAATATCGCTTTGTGCATTGTTGTGGGGTGTGGCCGGTCAGTACGAATGGCAAATACGCGATGCTTTTGACGAAGTCCGAGGGAAGATGGACAAGATTAATAGCGAAAATTGTTACATTAGTCATCTTGATGACTTATACCTCTCCGAAGACTCTGTTTCTCACCATCCCGACGTGAAAGAGATCAACATCAACCCGGTATTCCCAAACCGTACCGCGATGCTGCATTTGCACAATATGGCCATGAATAGAGCTTTTTTCTGGAGCTTCGTTCTCCAAACCAGGTTTATTAGACCCGCCATCAATGATACCTATGATCCTGGTATGATGTATTATTTCCTTTCGGCCGTTGCCGATGTGGCTGCCAATCCCTACATAAACGCTAGTGCAATATATTTCTCCCCAAATATGTCGTATACCTCGTCGTACAGAGGGTTCTTTAACAAGACCCTGCCGCGTTTTGCTCCCAGAGCATTCCGAGCTGATGATTTCAACGATCCTGTACACTTACAAAAAATATCTACTATGAACACGTTTATAATTGAAGATTTAGGTGCGTTCGAACCAGATAGCTTATCGAAAGACTATACGTCAGAATTCTACAGGACCAATGAGTGGTATAAGGTGTGGTTACCTGACAGAGTGGAAAGGCGTCATGATACTAAGACTACATATCAAGTGGAGATCAGATATGCTAACAATACAAACGAAACATTCACATTTCATGGTCCACCAGGGAATGATGAGACTCCTGGTCCAGTGAACTGGACCCGTCCATACTTTGATTGCGGTCGGCTGAGCAAGTGGTTAGTGGGTGCGGTTTCGCCTGTTGCTGATATATACCCTCGACACACGCAATTCAGACATATTGAATACCCCACTTACACGGCTGCCGTGGTGATGGAAATGGATTATGAGAGGATCGACATAAACCAGTGTCCTCCGAGTCCGGGCAACGACCGACCGAACAAGTTCGCATCGACGGCTCGATGCAAAGAAACAACAGAGTGCGAGCCGTTGGACGGGTGGGGCTTCCGTCGCGGCGGCTACCAGTGTCGCTGCCGGCCCGGGTACCGGCTGCCCAGCATCGTGCGCCGCCCCTACCTGGGGGAGATCATCGAGCGGGCCACCTCCGACCAGTACTACAACAACTTCGACTGCTCCAAGATTGGATGGATCCAAGGTCTGCCGTCGGAGCTGGAGAAGGCGCCGGCGTTCCTGCGCGCGGTGTACCGGGACCGCTACCACGAGTACGTGCAGGCGGCCACCGGGCCCGCCGCGCTGCACGCGCCGCGACCCAACGTCTACGAGATGCTCAACTTCATCCGCGGCGTGCGCCCGGACAACTGCTCCCGGTACAACCCCAGCGACCTGGTCCTGAACGGTGACTTGGCGTTCGGAGTCGAGAAGCAGCTGGAGAACCAAGCCAAGATGGCCCTGAGGCTGGCCAACTTCATCAGCGCGTTCTTGCAGGTGTCGGATCCACAAGAAGTGTTCAGCGGGAACCGAGTCGCCGACAAACCCCTGACCGAAGACCAGATGATAGGCGAGACCCTGGCCATCGTGCTCGGAGACTCCAAGATCTGGTCCGCCGGCACGTACTGGGACCGAGAGAAGTTCCCGAACCGCACGTACTTCGCGCCCTTCGCCTACAAGACCGAGCTCAACGTGAGGAAGTTCCGTCTCGAGGACCTGGCGCGACTCAACTCCACAGAGGAAGTGTACACGAACAAGCCCTGGTTCCAGTTCCTGAAGCAGCGCTGGTCGAGCAACTTCGACAGCCTCGAGCAATACTTCCTCAAGATGAACATCCGCGACTCGGAGGCCGGCAAGTACCTCAAGCACTACGAGCGCTTCCCGCACTGGTACCGGGCGGCGGCGCTGCGCCACGGGCACTGGACGCAGCCCTACTACGACTGCGGGGGCCGCGTGCCGCAGTGGGCCGTCACCTACGCCGCGCCCTTCTTCGGCTGGGACAGCGTCAAAGTCAAACTCGAGTTCAAAGGTGCGGTTGCGGTGACGATGTCATTGCTGTCTCTAGACATCAACCAGTGCCCGGACAAGTACTACGTGTCCAACGCATTCAAGGGAACGGATAAATGCGACAGGAGCTCGTCTTATTGCGTCCCGATCCTGGGCCGCGGCTACGAGGCGGGCGGGTACAAATGCGAGTGCCTGCAGGGCTTCGAGTACCCGTTCGAGGACCCCACCACGTACTACGACGGGCAGATCGTGGAGGCAGAGTTCCAGAACATCATACTCGACAAGGAGACGCGCATCGACATGTTCAAGTGCCGCCTGGCCGGCGCCGCAGCCCTGGGGCTCAGCCCCGCCCTGCTGCTCGCGCTGGTGGCCACGCTGGTCGGCCTGCGGTAG
Protein
MEKINCSLLAISLCALLWGVAGQYEWQIRDAFDEVRGKMDKINSENCYISHLDDLYLSEDSVSHHPDVKEININPVFPNRTAMLHLHNMAMNRAFFWSFVLQTRFIRPAINDTYDPGMMYYFLSAVADVAANPYINASAIYFSPNMSYTSSYRGFFNKTLPRFAPRAFRADDFNDPVHLQKISTMNTFIIEDLGAFEPDSLSKDYTSEFYRTNEWYKVWLPDRVERRHDTKTTYQVEIRYANNTNETFTFHGPPGNDETPGPVNWTRPYFDCGRLSKWLVGAVSPVADIYPRHTQFRHIEYPTYTAAVVMEMDYERIDINQCPPSPGNDRPNKFASTARCKETTECEPLDGWGFRRGGYQCRCRPGYRLPSIVRRPYLGEIIERATSDQYYNNFDCSKIGWIQGLPSELEKAPAFLRAVYRDRYHEYVQAATGPAALHAPRPNVYEMLNFIRGVRPDNCSRYNPSDLVLNGDLAFGVEKQLENQAKMALRLANFISAFLQVSDPQEVFSGNRVADKPLTEDQMIGETLAIVLGDSKIWSAGTYWDREKFPNRTYFAPFAYKTELNVRKFRLEDLARLNSTEEVYTNKPWFQFLKQRWSSNFDSLEQYFLKMNIRDSEAGKYLKHYERFPHWYRAAALRHGHWTQPYYDCGGRVPQWAVTYAAPFFGWDSVKVKLEFKGAVAVTMSLLSLDINQCPDKYYVSNAFKGTDKCDRSSSYCVPILGRGYEAGGYKCECLQGFEYPFEDPTTYYDGQIVEAEFQNIILDKETRIDMFKCRLAGAAALGLSPALLLALVATLVGLR

Summary

EMBL
NWSH01002281    PCG68698.1    KQ459011    KPJ04366.1    KQ460500    KPJ14267.1    + More
AGBW02014704    OWR41159.1    ODYU01008429    SOQ52021.1    KK852517    KDR22174.1    GANO01004947    JAB54924.1    KK107652    QOIP01000003    EZA48293.1    RLU25175.1    JXJN01011388    CCAG010009824    GBYB01012363    JAG82130.1    GL441773    EFN64304.1    GFDF01007260    JAV06824.1    KQ977329    KYN03563.1    GECZ01008177    JAS61592.1    GDHF01018747    JAI33567.1    KQ414613    KOC68943.1    KQ976719    KYM76760.1    GAKP01007884    JAC51068.1    KQ435824    KOX72199.1    ADTU01024910    GECU01022233    JAS85473.1    GBXI01004353    JAD09939.1    KQ981276    KYN43517.1    GAMC01014433    GAMC01014431    JAB92122.1    CH940650    EDW67672.1    KQ980159    KYN17422.1    CH933806    EDW16557.1    CH964251    EDW83151.1    KZ288269    PBC30019.1    OUUW01000007    SPP83093.1    GGFM01000749    MBW21500.1    UFQS01000993    UFQT01000993    SSX08322.1    SSX28345.1    KQ971316    EEZ98791.1    CP012526    ALC46707.1    CH902617    EDV43097.1    KQ761768    OAD57109.1    GGFK01003236    MBW36557.1    DS235250    EEB13934.1    CH479198    EDW28167.1    CH480842    EDW49622.1    CM000070    EAL27228.1    CH916374    EDV91106.1    AE014297    BT083386    AAN13829.2    ACQ66047.1    CM000364    EDX12183.1    CH954181    EDV48345.1    GGFJ01002180    MBW51321.1    GGFJ01002179    MBW51320.1    CM000160    EDW96174.1    CVRI01000039    CRK94642.1    ADMH02001372    ETN62735.1    AAAB01008987    EAA01581.4    APCN01000869    GEZM01080993    JAV61947.1    AXCM01010104    GL446282    EFN88130.1    AXCN02001173    SSX08319.1    SSX28342.1    APGK01053370    APGK01053371    APGK01053372    KB741223    ENN72369.1    ATLV01017444    KE525168    KFB42196.1    GBHO01040693    GBHO01040691    GBHO01016503    GBHO01016492    GBRD01016303    GDHC01006438    JAG02911.1    JAG02913.1    JAG27101.1    JAG27112.1    JAG49523.1    JAQ12191.1    JXUM01099340    JXUM01099341    KQ564484    KXJ72213.1    CH477255    EAT45901.1    UFQT01000380    SSX23745.1    DS231863    EDS39989.1    GDKW01001554    JAI55041.1    GL732663    EFX68045.1    GDIQ01038253    JAN56484.1    LRGB01000005    KZS22076.1    GDIP01173811    GDIP01118628    JAJ49591.1    GDIP01058340    JAM45375.1    ACPB03009759    GDIP01125801    JAL77913.1    GDIP01096691    JAM07024.1    GDIQ01117773    JAL33953.1    GEDC01016145    JAS21153.1    GDIP01023268    JAM80447.1    AJVK01018633    AJVK01018634    LNIX01000009    OXA50259.1   
Pfam
PF02487   CLN3
Interpro
IPR036259   MFS_trans_sf        + More
IPR020846   MFS_dom       
IPR003492   Battenin_disease_Cln3       
SUPFAM
SSF103473   SSF103473       

Ontologies

Topology

SignalP
Position:   1 - 22,         Likelihood:  0.982260
 
 
Length:
800
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
35.57521
Exp number, first 60 AAs:
10.83811
Total prob of N-in:
0.55280
POSSIBLE N-term signal
sequence
outside
1  -  776
TMhelix
777  -  799
inside
800  -  800
 
 

Population Genetic Test Statistics

Pi
2.647393
Theta
20.554613
Tajima's D
-1.484571
CLR
0.147033
CSRT
0.0621968901554922
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号