SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16448
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.073 PlasmaMembrane   Reliability : 1.175
 

Sequence

CDS
ATGGCAGAGATTAAGGTGACGGGCCTGGATGAGTGCGCTACTCAGATGGAAGTGGCCGCCGCTATTGCATCGCAGGGCAACTGCGCCCTCGCACAAGTGAAGGTGGGAGAGCTCCGGAGTTGTTACTCTGGGGCTTTCACCGTGTGGGCGCGTTGCCCCGTGCAGGCGGCCACCCTGTTGGCCACGCCTCCACAAGGTCGGCCTGCCGACTCGCCGGGGAGGCTGCGCGTGGGTTGGGTGATAGCCCACGTGCAGCTGCAGGAGGCACGTCCATGGCGATGCCTCCGGTGCTTTGGCACCGGGCACGGCCTCGCCAAGTGCCCGTCGGCTGTGGATCGCAGCGGACTTTGCTTCCGTTGCTGTCAGCCCGGACACAAGGCAGCCTCCTGCACCGCTGCAACACCGCACTGCGTGTTGTGTGATGCAGCGAAACGGCGGGCCGATCATCGGGCCGGGGGTCCGGCCTGTCTTTCCGCACCCTCCTCCACAAAGAGGAGGCGTGGCGGGAAAAAGAAGAAAAAGTCAGAGGAAGAGCCGGCTGCGTGTGAAACAGCCGGCCCGTCAGTTCCCGCCGCGGCCGTCGGGCCGCAAGGCGGGACGGAAGACGAGGGAGCGATGGACGATCTCCTCGTCCATACCATGGCGGAGTGGTTCATCGACATCGCGATCGTCGCGGAGCCATACTTCGTACCTTCCGACCGGGAGGACTCCTGGGCCGGAGATGTCGATGGCTCCGTGGCGATCGTGATGCGACAGTCGGCGGCGTTACCCCCCCTTGGAATGGTGGCCAGGGGATCTGGGTACGTCGTAGTTAGGGTCGACGAAACCGTCGTGATCGGGGTGTACTTCTCTCCGAACAGGAGTCTCGCCGAGTTCGAGCAGTTCCTGGGTGGGCTCGAGGCGTTGGTTCATCGCTTCGAGTCTCGCCCAGTGATACTAGCGGGGGACCTCAACGCTAAATGTACGGCGTGGGGATCCCCCCGCACGGACTCGCGTGGCGAATTCCTGTCGGAGTGGGCTTTCGCGACCGGCCTCTGTCTCCTAAACAGAGGTTCGGTCGCGACCTGCGTGCGGTGGAACGGGGAATCACACGTGGACGTATCGTTCGCGTCTCCGTCCGCCGCGCGCCGTGTCTGTGGTTGGCGTGTCCTCGAGGGGGCGGAGACGCTCTCGGATCATCGGTTCGTCCGATTTGAGCTCTCCGTTTCCACCTCGTTGAACGCGCCGGCCGAAGACGCCCGCGGCGAGGAGGAGCTCCCGCGTAGTGCTCCCCGATCATTCCCGCGATGGGCACTGAAGCGCCTGAACAAGGTGCTTGCGGTGGAGGCGGCCACAGTGGCCGCGTGGGCGCCGATGCCCGCGCGTCTAGTGGACGTGGAGTTGGAGGCCGAATGGTTCCGGGGTACGATGCGTCGCGTCTGCGATGCTGCGATGCCCCGGGTCAGCGGTCGCGCTCCGCGTGGCGGTGCGTACTGGTGGACGCCCGAGATCGCGCTCCTCCGAGAGGAGTGCGTGCGGGCGCGCCGCCGAAGCGCCCGCCACCGCCGTCGCCGCCTTCGCGATGCGGACTTCGCGGAGGTGGCGACCCGCCTGCATGCCGACTGCCGTCAGAAGCAGGAGGCACTGCGGCGGGCCATCGGCGAGGCCAAGTCTCAGAGCATGAAGACGCTCCTGGAGACGCTTGACCAAGATCCTTGGGGGCGCCCGTACCAAACGGTCCGCAAGAAATTGCGGCCGTGGGCGCTCCCGGTGACGGAACGTCTCCAGCCTCAGCAGCTGCGGGAGATTGTCTCCGGGCTGTTCCCGCGGATGGAGAGGGGCTTCGAGCCCCCTTCCATGGGCGCGCCACCACGCAGTAGCGTGAGCGGTGATGCCCCTGCTGAGGTGGTCCCTCCGAGCATCTCGGAGGAGGAGATTCGTGCGGCCGTGTCGAGGATGCGGAGGAAGGACGCGGCCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGGATTTGGCCTTCGGTGCCCTTGGGGACCGACTCGTGCGGCTCTATGAAGCCTGCCTCGAGTCGGGACGGTTTCCGAAGCAGTGGAAGACGGGCAGACTTGTTCTGCTAAGGAAGGAGGGACGCCCCGCGGACTCACCTGCGGGATATCGTCCCATCGTGCTGCTGGACGAGGCTGGAAAATTGCTCGAGCGGGTGGTGGCCGCCCGCATCGTCCAGCATCTGACGGGGGTGGGTCCCGATCTGTCAGCGGAGCAGTTCGGATTCAGGGAGGGCCGCTCGACCATCGACGCGGTGATGCGCGTGCGTGCCCTCTCTGATGAGGCTGTCGGCCAGGGCGGGGTTGCACTGGCGGTGTCCCTTGACATCGCCAACGCGTTCAACACCTTGCCCTGGTCGGTGATCGCAGGGGCGCTGGAGTATCACGGTGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGACAGGTCGGTCGTGTGCACCGGGCACGGTGGGGCGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCCTGCGTAGCGCCCTAAGTGCTCCTCTTCCGGGTCTGAGCGTAGTTTGTTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGTGCGGGGGTGGCCTTCGTCATCGGCAGGATCCGAAGGCTGGGTCTGGAGGTGGCGCTCGATAAATCCCAGGCCCTGTTGTTTCACGGGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCAACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCGGCTGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACTTGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGCACCGTCTCGTTTGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCCGGGGCGGCGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGAATGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGGGCGACACAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCGCTTTCGTGGAGCAGCGCCGCGTCCTCGTTGCAAATATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGAGCCGGGGTTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MAEIKVTGLDECATQMEVAAAIASQGNCALAQVKVGELRSCYSGAFTVWARCPVQAATLLATPPQGRPADSPGRLRVGWVIAHVQLQEARPWRCLRCFGTGHGLAKCPSAVDRSGLCFRCCQPGHKAASCTAATPHCVLCDAAKRRADHRAGGPACLSAPSSTKRRRGGKKKKKSEEEPAACETAGPSVPAAAVGPQGGTEDEGAMDDLLVHTMAEWFIDIAIVAEPYFVPSDREDSWAGDVDGSVAIVMRQSAALPPLGMVARGSGYVVVRVDETVVIGVYFSPNRSLAEFEQFLGGLEALVHRFESRPVILAGDLNAKCTAWGSPRTDSRGEFLSEWAFATGLCLLNRGSVATCVRWNGESHVDVSFASPSAARRVCGWRVLEGAETLSDHRFVRFELSVSTSLNAPAEDARGEEELPRSAPRSFPRWALKRLNKVLAVEAATVAAWAPMPARLVDVELEAEWFRGTMRRVCDAAMPRVSGRAPRGGAYWWTPEIALLREECVRARRRSARHRRRRLRDADFAEVATRLHADCRQKQEALRRAIGEAKSQSMKTLLETLDQDPWGRPYQTVRKKLRPWALPVTERLQPQQLREIVSGLFPRMERGFEPPSMGAPPRSSVSGDAPAEVVPPSISEEEIRAAVSRMRRKDAAPGPDGVHGRVWDLAFGALGDRLVRLYEACLESGRFPKQWKTGRLVLLRKEGRPADSPAGYRPIVLLDEAGKLLERVVAARIVQHLTGVGPDLSAEQFGFREGRSTIDAVMRVRALSDEAVGQGGVALAVSLDIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVQRGVPQGSVLGPLLWNIGYDWVLRSALSAPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDLVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSEWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCPAFVEQRRVLVANIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAERERESSSSLSAPCRRRRAGVRRRAFVQLQPL

Summary

EMBL
AB090825    BAC57926.1    AB078931    BAC06456.1    AB078935    BAC06462.1    + More
AB078929    BAC06452.1    AB078930    BAC06454.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ149896    PZC78733.1    LBMM01004272    KMQ92618.1    RSAL01003504    RVE40273.1    LBMM01012412    KMQ86235.1    LBMM01006671    KMQ90407.1    LBMM01006954    KMQ90166.1    LBMM01008278    KMQ89009.1    LBMM01003988    KMQ92922.1    LBMM01005474    KMQ91485.1    LBMM01008448    KMQ88867.1    LBMM01007036    KMQ90099.1    LBMM01006657    KMQ90417.1    LBMM01002052    KMQ95336.1    LBMM01015025    KMQ84953.1    LBMM01004634    KMQ92224.1    LBMM01008445    KMQ88871.1    LBMM01014122    KMQ85315.1    LBMM01008422    KMQ88894.1    LBMM01004262    KMQ92649.1    LBMM01008226    KMQ89040.1    LBMM01015285    KMQ84870.1    LBMM01007425    KMQ89740.1    ABLF02013358    ABLF02013361    ABLF02054869    GGMR01015159    MBY27778.1    ABLF02041886    ABLF02034925    ABLF02011183    ABLF02041884    GGMR01006838    MBY19457.1    ABLF02011238    GFXV01002090    MBW13895.1    ABLF02018942    ABLF02041885    GALA01001777    JAA93075.1    GFXV01003903    MBW15708.1    ABLF02023257    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GGFJ01001369    MBW50510.1    GGFJ01001370    MBW50511.1    KU543683    AMS38371.1    AB090815    BAC57906.1    LBMM01006996    KMQ90130.1    GALA01001776    JAA93076.1    GALA01000302    JAA94550.1    LBMM01006977    KMQ90149.1    GGFK01005660    MBW38981.1    ABLF02011927    GGFJ01001439    MBW50580.1    ABLF02009073    ABLF02030702    ABLF02042963    GGMR01019493    MBY32112.1    AB593321    BAK38639.1    LBMM01005465    KMQ91492.1    ABLF02004854    ABLF02041317    GGMR01012748    MBY25367.1    GGFL01004044    MBW68222.1    AB593325    BAK38646.1    KQ972691    KXZ75806.1    KQ971309    EEZ99146.1    ABLF02018098    ABLF02041557    ABLF02030663    ABLF02041312    GAKP01002292    JAC56660.1    GGFJ01001727    MBW50868.1    KQ972544    KXZ75869.1    GGFL01004046    MBW68224.1    GGFJ01001453    MBW50594.1    GGMR01004600    MBY17219.1    ABLF02027248    GFTR01008427    JAW07999.1    GGFL01001192    MBW65370.1    GGFJ01001454    MBW50595.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF01553   Acyltransferase
PF01421   Reprolysin
PF00098   zf-CCHC
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR000663   Natr_peptide       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=5.43906e-09,     Score=150

Ontologies

Topology

Length:
1267
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0157999999999999
Exp number, first 60 AAs:
0.00275
Total prob of N-in:
0.00020
outside
1  -  1267
 
 

Population Genetic Test Statistics

Pi
19.780531
Theta
10.551364
Tajima's D
0
CLR
307.52741
CSRT
0.380930953452327
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号