SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16429
Pre Gene Modal
BGIBMGA013868
Annotation
PREDICTED:_Down_syndrome_cell_adhesion_molecule-like_protein_Dscam2_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 1.344
 

Sequence

CDS
ATGACAGCGGACGGGAGCGTAACCACGCAACTGAACATATCACACGCGAGGGTCGAAGATGGAGGACTCTTCTCCTGTGTCGCTCATCACGCCGACAATAGCATAGCTCACCATGACAGACTTAATGTATACGGTCCTCCGTATATAAGAACTCTGCCGCCACTGAAGGTTCAAAGCGGACAGAGCGTGACACTTCGATGCCCCTACTATGGGTACCCAGTTAGAGAAATTGCCTGGGAATTCAAAGGGAAAGAAATAATAGCGGACACAACGACACAAACAAATCGCTTCAAAAGATTCACGAACCACACGAGCTTCAGTAAAGAAATTTACGGCCGAAAACCAAAATTAAGAGGAAGAAGACAATCTCCGACAATAACTGATGGGATCCTCAAGATACCAAAAGTTTTTAAGAACGACAACGGTGCTTTGTACTCGTGTATAGTGAAGAGTCCGTCTGGCGAAATGGCCAAGAGGTCCTTTGAACTGCTTGTGGTTGAGGCTCCTCAGCTAGAAGAAATCATGCTGGCTCCGGACCTTCACGAAGGCCAAATAGTCCAGATACACTGTAATCTAAAAAGCGGTGATTCACCCGTTTATTATTCTTGGCTGAAAGATGGGAAGAAGATACCTGTCAATCTAAAGATCGTCGAAAGGAGTCTGGAAGTTTTCAGTGTACTCATAATCAAGAATGTGTCTTTGGAACACTGCGGGGCGTACACGTGCGTCGCCGCCAATCACGTCGCCAAAGTAAACAAAACGGTCAACTTGTACATAAAAGTCGCACCGAAGTGGAACGAAGAGCCGCAGAACACTTCGCTATTGCTCGGTAGAAACGGTCACGTATGTTGTAGCGCCAACGGATACCCTGAGCCTCAAACGCATTGGCTCAAAAAAGACATTGTATCCGAAACTTGGAGACCAGTCTTGGAAATAGCCGGCGGTGGTGTATTAAGCTTGTCAAACGGATCTTTGATCTTTGATTCGGTGGCTCTCTCTGACGCTGGTTTGTATAATTGTCATCTCGAGAATGGTGTTGGGGAGCCACTTAGCAAAACCATTTGGATATCTGTCAATAAACCGGTAACTTTTGAGGCAGCCTCAAGGAATTTGACGGCAAAACTTGGTCAGCAAGTTTCAATAGAATGTTTAGCAAAAGGTGACGATCCTATTAGAATCACTTGGACCAGAAACGGGAAGCCAATCAATCCACTCACTCAAAGGGTTAGAATATCTGAAGTGAAGACAGATGATGGAGTAACTAGCGTACTTGAGTTGATACAAACTGAGACGACAGATGATGCCTTATATCAGTGCAGAGCTGGGAATCCGTATGGAGCCGACGTGTTTAGCGTTCACCTAACTATCTTAGAACCTCCAGCTCCACCGACGGATTTATCCGTAGACTTTGTAAAGAGTAGATCCGTAAAGCTGTCTTGGAGGGACAGTGCACGATCTTTGGCTCAGTTTTACAGTTTACAAATCGGGAACACGCAGAGATTATCTTGGGGTACTGCAAGAGTTATTAATGTTACCAGGTTAGATGAAATCCGGCACGCGATTGAGGTTGTAGACCTCACACCGGCTACCGGCTACAGCGCTCGTGTTGCTGGAGGTAATCAGGCGGATCTCAGTCACTACTCGCTTCCAATACGATTTACTACCACAGAAGAAGCACCATCCTCGCCACCATTAGGAGTTCAGTTAGAACAGACTGATTCACCAGGGGAGTTGATGGTCAGGTGGCTTCCGCCACCAGCTGATTCTCACAACGGACAAGTTTTAGGATATCGATTGAGAGCTGTTCCACAAATCAGTGGACTCAAAGAGAACGAGGAAAAAAGTGACAAGACAATCAAAACTGCGTCTTTATATGCAAAGCAAGAAACTATCCTCTCTGGTCTGCTAAAAGGCGTGAGGTATGCGGTCTCAATAGCGGCCTACAACAACGCAGGCACTGGCCCTTTTTCGGTGCCCTTATTTCAAGATACAAGAGAAGGAGCCCCAGAAGACGGTCCTACATCAGTGGAGTGCGGAGGGGTGACATCTACTGCTTTGAGGGTCAGCTGGCAACCTATCCCACCTCACAAGCAAGCCGGAGCTCTTATAGGGTACATAGTACTATATGCCGTTCAAGGACGACATTGGCTGAATTCCACATCCCTAGTGACGGAACTGCGCCTCCAAGGTTTGCTCAAATACACCAACTACAGTATTAAAGTGGCCGGATTCTCGAACTACGGACTTGGCCCGTTTTCATTCCCAATTATCTGCTCCACCTTACAAGACGTGCCTGATGCACCAGCTGAAATTAAATTACTCTCCCAATCATCCGCCACTCTGCTCGTCAGCTGGAAGAAGCCAAAACAACCTAATGGACGGCTGCTGTACTATACAGTTTACTGTAAGGCTACTGCCAGTAACGATGGACCTCAACAAATTCGAGTCGACGCCCAAACAAATTCGGAAGCTTATGAGAAATCACAAACCTTGGAGTTGAAAGGCCTCGTTGAAGGTCGGCAGTACGATGTATGGGTCACGGCTAGTACTGCAGCAGGAGAGGGTCCGGAGACCAGAAGAGTTACAAGTACTCCATTACAAAGAGTTGTGGCAGGAGTGGCTTCTCTAGGAGGAGAAATAACAGTGGCAGTAAGAAACTCCCTGCTTCTGGAGTGTAAAAGCGTCGGATCGCCCCCGCCGAGGAAGGTTTGGTATCACAACCAGAACATCATCACTCACCACCCAAGATTCACGAGGAATAGAGATGACAGTTTGTTGATCAAAAGTATAGACCAAGCTCTAAGCGGTAATTACACATGTCTAGCCAAAAACCTGTACGGTTCGGATTCGGTTGTGTATACAGTAAAAGTTCTACCCCTGCCTGATCCTCCAGCTTTGCGGGCCACCCCGTACAAGGATTACATTGTACTAGAATGGGACGAGACGAAGGATCACGAGAACGAATCCAGTTATGGAGTCAGTTACAATTTGACTTGGCGTGAAGTCGAAGGTCCTTGGCAAGAAGCTTGGCCAGCAGCAAGGGAAACCAGAATTAATGGCGTTCACCAGCATACTTTAACTGGTTTGAAATGCGGAACTAAGTACAGTATCAGGGTCACGGCCACTGATGCAATAGGTACTTCTGCACCAGCACACATCGACGTCACCACTTTAGGGGGAGCTCCTATATCTCCGTTGTCAAACGACTGGCTTTGGAGTAACGCGTCGCATATATACATTCAGCTGAGTGGTTGGGACGACGGCGGTTGTGACGTCACCAGATGGGACGTCGAATACCGACCTTTTGGCTCTAACACGTGGCGTAGGACTGAGAATAAAGCGTCCATGGACATGAACCTCGGATGGAGTTACATGGAAGGACACTACCAAGCTCCACCGCTGCGATCCATTCCATCTTCGTACGCGGTCGGCTCTCTCATTCCCGCCAGTTGGTACGAGCTGAGAGTGACTGCGATAAACGATGCCGGAGCCGCCTCTGCTGTGTACACGTATGCGACCAAGACCTTGGACGGCGAGGAAGTGGGCCCTCCCTTGGAGTTTTTCGACCTGAACATGCTAGTCATCGTCTGCAGCTCGATACTACTCGTCGTGTGTCTGCTGGCGTTTTTCTGTATACTACTAAAGAGGCATAGGCAAAACTACGCCTCCCAGTATCGACACTCGATTGCTGAGGAAGTCAAGTCCAGAAACGAGAGTGTCGCCTCGCATTCCGAACACAAGGACAGATACGCTCAGGCTCCAAGAATCTATACCTCGCCTGTGCAAATCCGCAAGGGTAGCAAAAATGAAATGTTCGAGATAAGTCCTTACGCCGAGTTTGCCTTGGGTTTCCGGACTTTTGACCACGTTGAGAACCAGGATCTGCCAAGCAGGCTTCCCAGTAGACCAAGGTTTGATACAGGTAAGAAAATTCACACAGGTACTGGTGGTAGGACTTCTAGTGAGTCCGCACAGATAGGTATTTCTGCCGTGAAGCAGTAA
Protein
MTADGSVTTQLNISHARVEDGGLFSCVAHHADNSIAHHDRLNVYGPPYIRTLPPLKVQSGQSVTLRCPYYGYPVREIAWEFKGKEIIADTTTQTNRFKRFTNHTSFSKEIYGRKPKLRGRRQSPTITDGILKIPKVFKNDNGALYSCIVKSPSGEMAKRSFELLVVEAPQLEEIMLAPDLHEGQIVQIHCNLKSGDSPVYYSWLKDGKKIPVNLKIVERSLEVFSVLIIKNVSLEHCGAYTCVAANHVAKVNKTVNLYIKVAPKWNEEPQNTSLLLGRNGHVCCSANGYPEPQTHWLKKDIVSETWRPVLEIAGGGVLSLSNGSLIFDSVALSDAGLYNCHLENGVGEPLSKTIWISVNKPVTFEAASRNLTAKLGQQVSIECLAKGDDPIRITWTRNGKPINPLTQRVRISEVKTDDGVTSVLELIQTETTDDALYQCRAGNPYGADVFSVHLTILEPPAPPTDLSVDFVKSRSVKLSWRDSARSLAQFYSLQIGNTQRLSWGTARVINVTRLDEIRHAIEVVDLTPATGYSARVAGGNQADLSHYSLPIRFTTTEEAPSSPPLGVQLEQTDSPGELMVRWLPPPADSHNGQVLGYRLRAVPQISGLKENEEKSDKTIKTASLYAKQETILSGLLKGVRYAVSIAAYNNAGTGPFSVPLFQDTREGAPEDGPTSVECGGVTSTALRVSWQPIPPHKQAGALIGYIVLYAVQGRHWLNSTSLVTELRLQGLLKYTNYSIKVAGFSNYGLGPFSFPIICSTLQDVPDAPAEIKLLSQSSATLLVSWKKPKQPNGRLLYYTVYCKATASNDGPQQIRVDAQTNSEAYEKSQTLELKGLVEGRQYDVWVTASTAAGEGPETRRVTSTPLQRVVAGVASLGGEITVAVRNSLLLECKSVGSPPPRKVWYHNQNIITHHPRFTRNRDDSLLIKSIDQALSGNYTCLAKNLYGSDSVVYTVKVLPLPDPPALRATPYKDYIVLEWDETKDHENESSYGVSYNLTWREVEGPWQEAWPAARETRINGVHQHTLTGLKCGTKYSIRVTATDAIGTSAPAHIDVTTLGGAPISPLSNDWLWSNASHIYIQLSGWDDGGCDVTRWDVEYRPFGSNTWRRTENKASMDMNLGWSYMEGHYQAPPLRSIPSSYAVGSLIPASWYELRVTAINDAGAASAVYTYATKTLDGEEVGPPLEFFDLNMLVIVCSSILLVVCLLAFFCILLKRHRQNYASQYRHSIAEEVKSRNESVASHSEHKDRYAQAPRIYTSPVQIRKGSKNEMFEISPYAEFALGFRTFDHVENQDLPSRLPSRPRFDTGKKIHTGTGGRTSSESAQIGISAVKQ

Summary

EMBL
RSAL01000157    RVE45570.1    KQ459602    KPI93210.1    KQ460353    KPJ15639.1    + More
NWSH01001472    PCG71143.1    NWSH01000925    PCG73523.1    AGBW02010096    OWR49171.1    BABH01025528    AGBW02011290    OWR46880.1    AGBW02010870    OWR47596.1    KQ459547    KPJ00029.1    KPJ00028.1    JRES01001161    KNC24949.1    CVRI01000006    CRK88017.1    KQ435922    KOX68634.1    CCAG010010693    CCAG010010694    CCAG010010695    CCAG010010696    CCAG010010697    GAMC01005845    JAC00711.1    CH964232    EDW80662.2    GL887813    EGI69926.1    QOIP01000005    RLU23107.1    CH902617    KPU80416.1    EDV43677.1    KQ978579    KYN30034.1    KQ978255    KYM95887.1    KQ971307    KYB29801.1    KYB29804.1    KYB29803.1    CP012526    ALC46292.1    KQ976453    KYM85408.1    KQ981920    KYN32984.1    ADTU01017524    ADTU01017525    ADTU01017526    ADTU01017527    ADTU01017528    ADTU01017529    ADTU01017530    ADTU01017531    ADTU01017532    ADTU01017533    CH940650    EDW67931.1    RSAL01000273    RVE43150.1    KRF83565.1    KRF83564.1    CM000160    KRK02722.1    KRK02724.1    BABH01027510    BABH01027511    BABH01027512    BABH01027513    EDW95788.2    KRK02725.1    GEHC01000744    JAV46901.1    CH933806    KRG01530.1    KRK02723.1    KRG01529.1    EDW15371.2    CH480827    EDW44727.1    CM000070    EAL27462.3    CH479179    EDW24064.1    OUUW01000005    SPP80648.1    KRT00044.1    KRT00043.1    KRT00045.1    KRT00046.1    KRT00048.1    KRT00049.1    KRT00047.1    AGBW02008880    OWR52305.1    KZ149956    PZC76468.1    NEVH01022635    PNF18619.1    PNF18616.1    PNF18614.1    ODYU01001341    SOQ37392.1    ODYU01002306    SOQ39628.1    JXJN01021159    JXJN01021160    KQ414632    KOC67128.1    AJWK01012559    AXCN02001019    AXCN02001020    ATLV01022806    ATLV01022807    ATLV01022808    ATLV01022809    ATLV01022810    ATLV01022811    KE525337    KFB47992.1    PZC76469.1    GL767674    EFZ13261.1    NEVH01020333    PNF21807.1    GL436519    EFN71841.1    APGK01020326    APGK01020327    APGK01020328    KB740193    ENN81073.1    KB631669    ERL85186.1    GGMS01016006    MBY85209.1    JH431989    NEVH01003751    PNF40057.1    PNF40058.1    ABLF02040815    ABLF02040826    CH477273    EAT45200.1    JXUM01071810    JXUM01071811    JXUM01071812    JXUM01071813    KQ562684    KXJ75330.1   
Pfam
PF00041   fn3        + More
PF07679   I-set
PF00047   ig
PF02854   MIF4G
PF10523   BEN
PF13895   Ig_2
Interpro
IPR013098   Ig_I-set        + More
IPR013783   Ig-like_fold       
IPR003599   Ig_sub       
IPR036116   FN3_sf       
IPR007110   Ig-like_dom       
IPR003961   FN3_dom       
IPR036179   Ig-like_dom_sf       
IPR003598   Ig_sub2       
IPR013151   Immunoglobulin       
IPR013106   Ig_V-set       
IPR003890   MIF4G-like_typ-3       
IPR016021   MIF4-like_sf       
IPR016024   ARM-type_fold       
IPR027413   GROEL-like_equatorial_sf       
IPR018379   BEN_domain       
IPR013087   Znf_C2H2_type       
IPR003006   Ig/MHC_CS       
SUPFAM
SSF48726   SSF48726        + More
SSF49265   SSF49265       
SSF48371   SSF48371       
SSF48592   SSF48592       
Gene 3D
PDB
3DMK     E-value=4.70652e-39,     Score=410

Ontologies

Topology

Length:
1333
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.89303
Exp number, first 60 AAs:
0.0002
Total prob of N-in:
0.00019
outside
1  -  1191
TMhelix
1192  -  1214
inside
1215  -  1333
 
 

Population Genetic Test Statistics

Pi
281.593145
Theta
176.500878
Tajima's D
2.324345
CLR
0.351554
CSRT
0.925153742312884
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号