SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16423  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013860
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.627 Nuclear   Reliability : 1.154
 

Sequence

CDS
ATGAAGTTTTACATATTCGTTGCTTTAATTTTAACTAACGGTAAAGAAGCGGCGCGGATTTTGGGGGTTTTTCCGGTGCCCTCAATCAGCCACCAAGTGGCTTTCCGACCTTTAACATTAGAGCTAGCAAAACGAGGCCACGAGCTAGTCGTCCTCACGCCAGATTCTGTCTTCGCTAAAGGGAAATCTCCAGAAAACTACACAGAAATAGATGTCCATGACATATCTTACCAAATTTGGACAAAAAGCTTCCTTGAAACATCAAGAGGAAAACGTCAAGATCTCTTCGAACAAACTAGAGTAGCAATGGATATACTGTATGATATTTTTTCCCAACAATTATTGACCGATGAGTTCCAAGCTATACTAAAAAGCAAAAAAAAGTTCGATTTGCTAATTCTAGAAGCCATAGTGAGACCGGCCAGGATTCTTTGTCACGTGTTCAATGCACCCGCTGTCATCATAAGTTCTTTCGGCGGCTTTGGAGATATTTATGACATAGTTGGAGCCGCAACCCATCCATTGCTGTATCCAGTTGTGACGCGGCAAAAACTTTACAATCTATCGTTTTGGGAAAAGTTAAGTGAAATGCATAATCGTTATACCTTTACCCGCATGTGGAAAGAGTTCGACAAGAAAGAGAATGAGATGGTTAAGAGCGTCTTTGGCCCCAATATCCCATATTTAAGCGAAATGGTGGATAGAATCAGCTTGATACTATTGAACGTACATTCGACCTGGGAACAGAATCGTCCGGTTCCACCGAATTTTATTTACGTTGGAGGAATCCATCAGAAGCCACAACAGGAATTGCCTTCGGATCTTAAAACCTATTTAGATTCATCCAAACACGGGGTGATATACATCAGTTTTGGGACGAACGTGATACCTTCGCTGTTGCCACCAGAACGAATCCAAATCCTGATTAAAGTGTTCTCCCAACTGCCCTACGATGTGCTGTGGAAGTGGGATAAAGATGAGCTGCCGGAAAAGTCGAAAAACATCAGGATTTCAAAGTGGCTGCCACAATCTGATCTGCTTAGGCATCCAAAGATCAAAGTTTTCATTACCCAAGGTGGTCTGCAGTCAACAGAAGAAGCAATCACTGCCGGAGTACCCCTAATTGGGATGCCGATGCTGAGCGACCAGTGGTACAACGTGGAGATGTACTTGATTCATAAAATCGGATTAAGACTTGAGCTGGATGAGCTTTCTGAAGAGAGACTCCGGAATAACATTGAAGAGATCATCGATAACGAAAGCTATCGTCAGAACATAGCTCGTCTCCGGAGCCAGATGTACGACCAGCCTCAGAGCTCATTGGAGCGCGCCGTGTGGTGGACGGAGCACGTGCTGCGTCACGGAGGAGCCCAGCATCTCCGAGCTGCCGGCGCCAATCTATCCTGGTCACAATACTTGGAATTGGAATTAGTTTCAGTATTACTCAACATAGAAATGAAGTTTTATATATTACTTGCTTTAATTTTAACTGACGGGAAAGAAGCGGCACGGATTTTGGGCGTTTTTCCGGTGCCCTCAATCAGCCACCAAGTGGCTTTCCGACCTTTAACATTAGAGCTAGCAAAACGAGGCCACGAGCTAGTCGTCCTCACGCCAAACCCTGTCTTCGCTAAAGGGAAATCTCCAGAAAACTACACAGAAATAGATGTCCATGACATATCTTACCAAATTTGGACAAAAGGCTTCCTTGAAACATCAAGAGGAAAACGTCAAGATATCTTCGAACAATCTAGAGTAGCAATGGATGTACTGTATGATATTTTTTCCCAACAATTATTGACCGATGAGTTCCAAGCTATACTAAAAAGCGAAAAAAAGTTCGATTTGCTAATTTTAGAAGCCATGATGAGACCGGCCAGGATTCTTTGTCACGTGTTCAATGCACCCGCTGTCATCATAAGTTCTTTCGGCGGCATTGGAGATATTTATGACACAGTTGGAGCCGCAACCCATCCATTGCTGTATCCAATTGTGACGCGGCAAAAACTTTACAATCTATCGTTTTGGGAAAAGTTAAGTGAAATGCACAATCATTATACCTTTGAACGCATGTGGAAAGAGTACGACAAGAAAGAGAATGAGCTGGTTAAGAGCGTCTTTGGCTCCAATGTCCCAAGTTTAAGCGAAATGGTGGATAGAATCAGCTTGATACTATTGAACGTACATTCGATTTGGGAACAGAATCGTCCGGTTCCACCGAATCTTATTTACGTTGGAGGAATCCATCAGAAGCCACAACAGGAATTGCCTTCGGAGGAGAGGGAGCTATTTTCCCCTCGGGTCTCTTTGGCGCGCTCGCCGCCTAGGGGACCGACTGCACCTCTGCCGGCGCCTATGCCGCCGCCGGCCCCCCGGGGGGTTAGGGCGGGAGCGGCTATGAGTGCCAAAGGCCGGAGGACCGGCCTGCATATCCCGGTTGCTTCTGGACTGTCGTCCTCGGCGCCTGTCACCCCGGTTGACCCAGTGGCTGGTGTCCCTAGCTTCCCCATTCCTGTTGCGTCGGGGGCTCCGACTGGACCCCTTGATGTAGCAGCGCAGGGGAGGCTGGAGCTGCTCGAGCGGGCAAACCGAGCGGTGCGCGGGATCATGTCGGTGGCGACGGCGGCATCTAAGCTCAATAAGTCGGAGGTCAATCTAATCTCTGAACTCGGTCGCGATATCCTGGCCGTAGTTGGGGCCCTCGGGATCCAGCTCTCTGATAAGGAGCTGGTGGTCGAAAGGCTCCGCTCGGCAGAGGCCTCTGCACGGCGTGACTCCGTGGCGCCTTCGATGGCTGCTGGTGCGGCGGCCGGGTCTGGGACTGGGCCTGCGACCTTCGCCACTGTCCTCAGGACGGGCCCTGGTGGGGTCCCGAGGTCCATTGGGGCCTCTCAGGGGCCTTCCTTGGCATTCTACCCGTCCGAGGGCAATGCGGAACTGAAGACAGCTGAGGACACAAAGAAAGAGGTAAAAAAGGCCATTGACCCTAAGTCAATGGCTATTGGAATACAGAGCGTAAGGAAGGTTGGGAATGCGGGGGTAGTGGTGCAGACCACGTCCCCCGCGGCCGCAGTCAAGCTTAGAAATGCTGCCCCGCCATCACTGAGAGTCACCGAACCCAGGCGCCGACAGCCCTTAGTAGCTGTCAATGGCGTGGAGGGCGACCCCTGCTTCGAGGAGGTAATCGAGTGCCTGGCTAGCCAGAACCTCGACCCGGAGGAGTGGCCCCTCACTAGGGTACGAGCGGAGCTCACGGGGGCGTTCAAAAAGGGGAGGCGACAATCCAACAACACTACTGTGGTGTTTAACGCCTCCCCTCGCATCAGGGACGCCCTCGTGAAGATTGGCAGAGTGTATGTGGGGTCGAGTATGGATATTAGGCCCCGACTTCGTATTGGCCAAATCAATCTGGGTGGTGCAGAGGATGCGACGAGGGAGCTACCCTCCATTGCACGGGATCTCGGCCTGGATATTGTTCTTGTACAGGAACAATATTCCATGGTCGGGTTCCTAGCCCAATGTGGAGCACACCCCAAGGCGGGTGTGTATATCCGCAATAGGGTGCTCCCCTGCGCGGTTCTGCACCACCTTAGCAGCACACATATAACGGTAGTGCACATTGGGGGGTGGGACTTATATATGGTGTCTGCGTACTTCCAGTATAGTGACCCTATTGACCCATACCTGCACCGGCTCGGGAATATTCTTGACCGGCTGCGGGGGGCTCGGGTCGTTATCTGCGCAGACACTAATGCCCACTCGCCATTGTGGCACTCGCTGCCCAGGCACTACGTCGGTCGGGGTCAGGAAGTGGCTGACCGCCGCGCCAAGATGGAGGATTTCATTGGGGCGAGGCGGTTGGTCGTCCATAACGCGGATGGCCACCTGCCGACCTTCAGTACGGCGAACGGAGAATCTTATGTCGATGTCACGCTGTCTACGCGGGGAGTACGCGTGTCTGAATGGCGTGTAACTAATGAATCATCGAGCGATCACCGGCTCATTGTGTTTGGGGTGGGGGGCGGTACAACAGGGGAGCGGGACGAGGACGAGGAGGCGCGGAGCGATTTGAGGCCGGGCGAGCCGTGCGCACTGCGTCGGTACCGGGACCGTGGGGTGGATTGGGACCTCTTCAGATCGCGTATCCACGAGCGAATGGGGAGTCTGGACCTCGAGGAACCTGTGGCTGCCCTTTGCGAAAAATTTACCGGGGTTATAACTCGCACAGCTGAAGAATGCTTAGGATCACTGAAAGCAGATAGAACTGACAGGGGTTATGAGTGGTGGACCCCAGTACTCGATAAGCTTAGGGTAGCCCAGGGTAGGGCCAGGCGTCGATGGCAAAAGGCCCGCCGAACGGGGGGTGAGGAAGAGGAGCAGTCTGGGAGAGTCTTCCGCGACCGCAGGCGCGAGTATCGAAGAGCGATGCATGACGCTGAGACCGCCTTTTACCGGGAGATCGCTGAAGGGGGAAACCGTGACCCGTGGGGACTAGCGTATCGGACGGCGAGTGGTAGGCGACGCGCACCAACTAATGTGGTTAACGGGGTGGAGTATGCGGGGCGGTGCTCGGATGATGTGAGTGGGGCCATGCGCACCTTGATGTGGGCGCTGTGTCCGGATGACTATATGTCTCGGGACACTCCGTACCATGCGCGGGTGCGTATCATGGCCGCGCTCCCCCCATCCGGGCGGGACGCAGACCCGCTGAGCAAAGACTCCCTTCGTGCCATAATTGGCTCACTGAAGAATACCGCACCGGGCATCGACGGTTTAACGGCGCGCATTATCAAAAAGGCACTTCCGGCTGCTGAGGCCGAGTTCGTGGCCGTATACGCACGGGGAAAGTTTCAGCGTCCCCCTATAGTCCGGTACGGCAGTCATGTCATTCGGTTCGAGAACCAGGTGACGGTGTTGGGCGTCGTCTTCGACGATTGCCTCTCTTTCGCGCCGCATGCGGCGGCCATTGGCGAGAGGGCGAGCAGGTGCTTCGGCAAGATGTCTAGAGTTTCGGCTTCGGCTTGGGGGCTGCGATATAGGGCTTTGCGTGTCTTGTACATGGGCACTTATGTTACAACCCTTACCTATGCGGCGGCCGTATGGTATTTGCGGGCTGCTGTGCACGTCGTGCGCAGCGTGCTGCTTAGGACGCAGCGCCCGTCGTTGACGCTGCTAACGAAGGCCTACCGTTCGTGCAGCACGGCTGCTTTGCCGGTGTTGGCGGGCGTCCTGCCGGCGGACCTGGAGGTGACTCGTGCTGGACGGAGGATGCGGGAGTGCGAAGGATTGGCGCGGGAGTTGGCGGCGGAGAGACGACGACGGATCGACGGCGATGTCTTGGTAGTTTGGCAGAACAGGTGGGTGTCTGAGGGTAAGGGGAGGGAACTGTACAAGTTCTTTCCCGATGTTGCGGACAGGAAGAAGGCAACGTGGATGGAGCCGGACTATCAGACCTCGCAGATCCTCACGGGTCATGGGATCTTTAATAAGCGGTTGGCGGATATGCGACTGAGGGAGGGGCATGCTTGCGACTGCGGGGCGGTTGAGGAGGATAGGGACCATGTCCTGTGGGAGTGTCCTCTCTATGACGAAATCCGGGGCAGGATGCTCGATGGAATCTCGCGGTCTGAGGTGGGCCCAGTTTACCACGCGGACCTGGTCAGGGACGAGAAAAATTTTCGGCTCTTGCGCGAGTTCGCGCATACATGGCACACGGCGCGCACTGCGCGCGAATCACGAGGACTGCCTGGCGACGAAGAATGGCATCCAAAGATCAAAGTTTTCATTACCCAAGGTGGTCTGCAGTCAACAGAAGAAGCGATCACTGCCGGAGTACCCCTAATTGGGATGCCGATGTTGGGCGACCAGTGGTACAACGTGGAGATGTACTTGATTCATACAATCGGATTAAGACTTGAGCTGGATGAGCTTTCTGAAGGGAGACTCCGGAATAATATTGAAGAGATCATCGATAATGAAAGCTATCGTCAGAACATAGCTCGTCTCCGGAGCCAGATGTACGACCAGCCTCAGAGCTCATTGGAGCGCGCCGTGTGGTGGACGGAGCACGTGCTGCGTCACGGAGGAGCCCAGCATCTCCGAGCTGCCGGCGCCAATCTCTCCTGGTCACAATACTTGGAATTGGAATTAGTTTCAGTATTACTCATTAGTTTTCTTATAACACTAACGATTTTGAGTTACATTATATTGTATTTATGGAGGCTTCTACGTACTTACAAAGATATAGTTAAAATTAAAAGATCTTAA
Protein
MKFYIFVALILTNGKEAARILGVFPVPSISHQVAFRPLTLELAKRGHELVVLTPDSVFAKGKSPENYTEIDVHDISYQIWTKSFLETSRGKRQDLFEQTRVAMDILYDIFSQQLLTDEFQAILKSKKKFDLLILEAIVRPARILCHVFNAPAVIISSFGGFGDIYDIVGAATHPLLYPVVTRQKLYNLSFWEKLSEMHNRYTFTRMWKEFDKKENEMVKSVFGPNIPYLSEMVDRISLILLNVHSTWEQNRPVPPNFIYVGGIHQKPQQELPSDLKTYLDSSKHGVIYISFGTNVIPSLLPPERIQILIKVFSQLPYDVLWKWDKDELPEKSKNIRISKWLPQSDLLRHPKIKVFITQGGLQSTEEAITAGVPLIGMPMLSDQWYNVEMYLIHKIGLRLELDELSEERLRNNIEEIIDNESYRQNIARLRSQMYDQPQSSLERAVWWTEHVLRHGGAQHLRAAGANLSWSQYLELELVSVLLNIEMKFYILLALILTDGKEAARILGVFPVPSISHQVAFRPLTLELAKRGHELVVLTPNPVFAKGKSPENYTEIDVHDISYQIWTKGFLETSRGKRQDIFEQSRVAMDVLYDIFSQQLLTDEFQAILKSEKKFDLLILEAMMRPARILCHVFNAPAVIISSFGGIGDIYDTVGAATHPLLYPIVTRQKLYNLSFWEKLSEMHNHYTFERMWKEYDKKENELVKSVFGSNVPSLSEMVDRISLILLNVHSIWEQNRPVPPNLIYVGGIHQKPQQELPSEERELFSPRVSLARSPPRGPTAPLPAPMPPPAPRGVRAGAAMSAKGRRTGLHIPVASGLSSSAPVTPVDPVAGVPSFPIPVASGAPTGPLDVAAQGRLELLERANRAVRGIMSVATAASKLNKSEVNLISELGRDILAVVGALGIQLSDKELVVERLRSAEASARRDSVAPSMAAGAAAGSGTGPATFATVLRTGPGGVPRSIGASQGPSLAFYPSEGNAELKTAEDTKKEVKKAIDPKSMAIGIQSVRKVGNAGVVVQTTSPAAAVKLRNAAPPSLRVTEPRRRQPLVAVNGVEGDPCFEEVIECLASQNLDPEEWPLTRVRAELTGAFKKGRRQSNNTTVVFNASPRIRDALVKIGRVYVGSSMDIRPRLRIGQINLGGAEDATRELPSIARDLGLDIVLVQEQYSMVGFLAQCGAHPKAGVYIRNRVLPCAVLHHLSSTHITVVHIGGWDLYMVSAYFQYSDPIDPYLHRLGNILDRLRGARVVICADTNAHSPLWHSLPRHYVGRGQEVADRRAKMEDFIGARRLVVHNADGHLPTFSTANGESYVDVTLSTRGVRVSEWRVTNESSSDHRLIVFGVGGGTTGERDEDEEARSDLRPGEPCALRRYRDRGVDWDLFRSRIHERMGSLDLEEPVAALCEKFTGVITRTAEECLGSLKADRTDRGYEWWTPVLDKLRVAQGRARRRWQKARRTGGEEEEQSGRVFRDRRREYRRAMHDAETAFYREIAEGGNRDPWGLAYRTASGRRRAPTNVVNGVEYAGRCSDDVSGAMRTLMWALCPDDYMSRDTPYHARVRIMAALPPSGRDADPLSKDSLRAIIGSLKNTAPGIDGLTARIIKKALPAAEAEFVAVYARGKFQRPPIVRYGSHVIRFENQVTVLGVVFDDCLSFAPHAAAIGERASRCFGKMSRVSASAWGLRYRALRVLYMGTYVTTLTYAAAVWYLRAAVHVVRSVLLRTQRPSLTLLTKAYRSCSTAALPVLAGVLPADLEVTRAGRRMRECEGLARELAAERRRRIDGDVLVVWQNRWVSEGKGRELYKFFPDVADRKKATWMEPDYQTSQILTGHGIFNKRLADMRLREGHACDCGAVEEDRDHVLWECPLYDEIRGRMLDGISRSEVGPVYHADLVRDEKNFRLLREFAHTWHTARTARESRGLPGDEEWHPKIKVFITQGGLQSTEEAITAGVPLIGMPMLGDQWYNVEMYLIHTIGLRLELDELSEGRLRNNIEEIIDNESYRQNIARLRSQMYDQPQSSLERAVWWTEHVLRHGGAQHLRAAGANLSWSQYLELELVSVLLISFLITLTILSYIILYLWRLLRTYKDIVKIKRS

Summary

Uniprot
ProteinModelPortal
PDB
2EI9     E-value=1.53799e-128,     Score=1183

Ontologies

Topology

SignalP
Position:   1 - 17,         Likelihood:  0.791192
 
 
Length:
2088
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
30.03873
Exp number, first 60 AAs:
0.07116
Total prob of N-in:
0.01142
outside
1  -  2050
TMhelix
2051  -  2073
inside
2074  -  2088
 
 

Population Genetic Test Statistics

Pi
25.270257
Theta
149.235143
Tajima's D
1.898126
CLR
0.132405
CSRT
0.863706814659267
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号