SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16422  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013860
Annotation
UDP-glycosyltransferase_UGT33D5_precursor_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.227
 

Sequence

CDS
ATGATAGTGTATTTTGTGGCAATTTTACAAGAAATACAAGCGGCTCGGATCCTAGGCGTGTTCCCTATACCCTCAATCAGTCATCAAGTAGTCTTCCGTCGTCTGACCTTAGAGCTTCACAAAAGGGGTCATGAACTAGTGGTTGTGACCACTGACCCTGTGTTCAAAACAGGACAAGCACCTGCGAATTACACAGAAATAGATGTACATGACGTTTCTTATTCAGCCTGGAGAGACGGCTTCATGAAAACCTCTAAAGGAAACGCTAATGATCTTTACGAACAAATCGCCATTGCTTTAAACTTGGGCATAGATTTGCTTGAACTACAAATGAAAAACAAAGAAGTCCAAGCGTTGCTAAGGAAGAGAAAAGAGAAGAAGTTTGATTTGCTCCTTCTAGAAGCATGCATCAGATCAACGATGGTCTTGACGCATGTGTTTGATGCACCGGCAATCCTCATCAGTTCATTTGGAGGTGTAGAATTCATGTCGAAAATGATGGGTGTCCCAACCCATCCTATTTTATATCCACCACCGTTGCATCAAAGACTTTATAATTTAACGTTCTTGGAGAAAATCGGTGAGATATACACCCATTACTATATGGAGTATCTATATTGGCGATCTGAACCCCAGGAGAATCAAATGGCAAAAAGGCTTTTCGGCCCGAACACTCCAACTATCAGAGAAACCCAGAAGAACGTACAGATGGCACTCCTGAATGTACACGCGATTTGGGAGGAAAATCGTCCTGTCCCTCCGAATGTTATATACATTGGAGGTATTCATCAGAATCCAGAAAAAAACTTGCCCAAGGATTTGAAGGAATATTTAGACTCTTCAAAACATGGCGTTATATACATTAGTTTCGGCACCAACGTGGAACCATCGTTACTACCTCCAGAACGGATTCAACTCTTCATTAAAGTGTTCTCCGAACTGCCTTACGATGTGCTCTGGAAATGGGACAAAGATGAACTGCCCGGGAGCTCAAAGAACATCAGAATAGCAAAGTGGCTGCCTCAATCAGATTTACTTAGACACCCAAAGATCAAGGCGTTCATAACTCAAGGGGGTCTGCAATCGACCGAAGAAGCGATCACAGCTGGAGTGCCACTGATTGGAATGCCTATGTTGATGGACCAGTGGTACAATGTCGAGAAATACGTTCGACACAACATCGGTTTGAGACTCGATTTGGGTTCCGTTACAGAGGAATCTCTCAGAAATGCCATCAACACTATCACTGGTGACGAAAGCTACCGTCAGAATATAGCTCGTCTCCGTAGTCAGGTCTACGATCAGCCCCAGAGCTCAGTAGACCGCGCCGTGTGGTGGACTGAGCACGTGCTGCGCCACGGAGGAGCCACTCATCTCCGAGCCGCAGGAGCCTTGAAATCTTGGACTGAATATTTTGAACTAAATTTAATTGCAGTTTTACTAGTCACTTTCCTAATTGTTATTGCATTAATTGCAAGCAACGGTGTGTTCCAAAGAGTACTTGTGATGACAAATATGTTTTCTTTAAACAAGATAGTGCTTATTGTGACAATTATACACGGAACCCAAGCGGCTCGGATCCTAGGCGTGTTCCCTACACCCTCAATCAGTCATCAAGTAGTCTTCCGTCGTCTGACCTTAGAGCTTCACAAAAGGGGTCATGAACTAGTGGTTGTGACCACTGACCCGGTGTTCAAAACAGGACAAGCACCTGCGAATTACACAGAAATAGACGTACACGACGTTTCTTATTCAGCCTGGAGAGACGGCTTCATGAAAACCTCTAGGGGAAGCGCCAATGATATTTACGAACAAATTTCCAGAATGTTGAACTTAAGAATAGATTTGTTTGAATTGCAGATGAAAAATAAAGAAGTGCAGTCGCTGCTGAGTAAGAGAAAAGAGAGCAAGTTTGATTTGCTCCTTCTAGAAGCATGCATCAGACCAACGATGGTCTTGACGCATGTGTTTGATGCACCAGCAATCCTCATCAGTTCATTTGGGGGTGTAGAATTCGTCTTGAAAATGATTGGTGTCCCAACCCATCCTATATTATATCCACCTTCCTTGCACCAACGAATTTATAACTTAACATTTTCGGAGAAAATCCGAGAGGTTTACACTCATTACTATTTGGAATATCTATATTGGCGATCTGAACCCCAGGAGAATCAAATGGCAAAAAGGCTTTTCGGCCCGAACACTCCAACTATCAGAGAGACACAGAAGAACGTGCAGATGGCACTCCTGAATGTACACGCGATTTGGGAGGAAAATCGTCCTGTCCCTCCGAATGTTATATACATTGGAGGTATTCATCAGAATCCCGAAAAGGAATTGCCCAAGGATTTGAAGGAATATTTAGACTCTTCAAAACATGGCGTTATATACATTAGTTTCGGCACCAACGTGGAACCATCGCTACTACCTCCAGAACGGATTCAAATCCTCGTCAAAGTATTTTCCAAGCTGCCTTACGATGTGCTCTGGAAATGGGACAAAGATGAACTGCCCGGGAGCTCAAAGAACATCAGAATAGCAAAATGGCTGCCTCAATCAGATTTACTGAGACACCCAAAGATCAAGGCATTCATAACTCAAGGGGGTCTGCAATCGACGGAAGAAGCAATCACAGCTGGAGTGCCACTGATTGGAATGCCTATGTTGATGGACCAATGGTACAATGTCGAGAAATACGTTCGACACAACATCGGTTTGAGACTCGATTTGGGTTCCGTTACAGAGGAATCTCTCAGGAACGCCATCGACACTATCACTGGTGATGAAAGCTACCGTCAGAACATAGCTCGTCTCCGTAGTCAGGTCTACGATCAGCCCCAGAGCTCAGTTGACCGCGCCGTGTGGTGGACTGAGCACGTGCTGCGCCACGGAGGAGCCACTCATCTCCGAGCTGCAGGAGCCCTGAAATCTTGGACTGAATATTTTGAACTAAATTTAATTGCAGTATTATTAGTTACTTTCCTAATTATAATTACATTCATAGCAAAATTAATATCTTCGTTTGTGAGGTCATTGAAAATGTATTTCAATTATAATGATAAAGTAAAATTACATTGA
Protein
MIVYFVAILQEIQAARILGVFPIPSISHQVVFRRLTLELHKRGHELVVVTTDPVFKTGQAPANYTEIDVHDVSYSAWRDGFMKTSKGNANDLYEQIAIALNLGIDLLELQMKNKEVQALLRKRKEKKFDLLLLEACIRSTMVLTHVFDAPAILISSFGGVEFMSKMMGVPTHPILYPPPLHQRLYNLTFLEKIGEIYTHYYMEYLYWRSEPQENQMAKRLFGPNTPTIRETQKNVQMALLNVHAIWEENRPVPPNVIYIGGIHQNPEKNLPKDLKEYLDSSKHGVIYISFGTNVEPSLLPPERIQLFIKVFSELPYDVLWKWDKDELPGSSKNIRIAKWLPQSDLLRHPKIKAFITQGGLQSTEEAITAGVPLIGMPMLMDQWYNVEKYVRHNIGLRLDLGSVTEESLRNAINTITGDESYRQNIARLRSQVYDQPQSSVDRAVWWTEHVLRHGGATHLRAAGALKSWTEYFELNLIAVLLVTFLIVIALIASNGVFQRVLVMTNMFSLNKIVLIVTIIHGTQAARILGVFPTPSISHQVVFRRLTLELHKRGHELVVVTTDPVFKTGQAPANYTEIDVHDVSYSAWRDGFMKTSRGSANDIYEQISRMLNLRIDLFELQMKNKEVQSLLSKRKESKFDLLLLEACIRPTMVLTHVFDAPAILISSFGGVEFVLKMIGVPTHPILYPPSLHQRIYNLTFSEKIREVYTHYYLEYLYWRSEPQENQMAKRLFGPNTPTIRETQKNVQMALLNVHAIWEENRPVPPNVIYIGGIHQNPEKELPKDLKEYLDSSKHGVIYISFGTNVEPSLLPPERIQILVKVFSKLPYDVLWKWDKDELPGSSKNIRIAKWLPQSDLLRHPKIKAFITQGGLQSTEEAITAGVPLIGMPMLMDQWYNVEKYVRHNIGLRLDLGSVTEESLRNAIDTITGDESYRQNIARLRSQVYDQPQSSVDRAVWWTEHVLRHGGATHLRAAGALKSWTEYFELNLIAVLLVTFLIIITFIAKLISSFVRSLKMYFNYNDKVKLH

Summary

Similarity
Belongs to the UDP-glycosyltransferase family.
Belongs to the peptidase S1 family.
Pfam
PF00201   UDPGT        + More
PF00089   Trypsin
Interpro
IPR035595   UDP_glycos_trans_CS        + More
IPR002213   UDP_glucos_trans       
IPR033116   TRYPSIN_SER       
IPR001314   Peptidase_S1A       
IPR009003   Peptidase_S1_PA       
IPR001254   Trypsin_dom       
IPR018114   TRYPSIN_HIS       
IPR006326   UDPGT_MGT       
SUPFAM
SSF50494   SSF50494       
PDB
2O6L     E-value=3.92996e-27,     Score=306

Ontologies

Topology

Length:
1025
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
66.6076500000001
Exp number, first 60 AAs:
0.3199
Total prob of N-in:
0.03257
outside
1  -  470
TMhelix
471  -  493
inside
494  -  499
TMhelix
500  -  522
outside
523  -  986
TMhelix
987  -  1009
inside
1010  -  1025
 
 

Population Genetic Test Statistics

Pi
188.42675
Theta
175.766254
Tajima's D
1.111697
CLR
0.525218
CSRT
0.688965551722414
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号