SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16420
Pre Gene Modal
BGIBMGA013830
Annotation
UDP-glucosyltransferase_precursor_[Bombyx_mori]
Full name
UDP-glucuronosyltransferase      
Location in the cell
Cytoplasmic   Reliability : 1.782
 

Sequence

CDS
ATGCTCTTAATCACAATTCTGCAAGGAACTAAAGCGGCTAGAATTTTAGGAGTGTTCCCTACACCATCAATCAGTCATCAAGTAGTCTTCCGACGTCTCACCTTAGAGCTTCACAAAAGAGGTCACGAACTAGTAATCGTCACAACTGACCCTATGTACCAGAAAGGCGAAGCCCCTCAAAACTATACAGAAATCGACGTGCATGACATTTCGTACACAACTTGGAGAAATGACTTCATGAAACTTTCCAGAGGAAGCTCCGATGATCTTTTCGAACAATCAGCTGTTATATTGGAATTAACTACGAATTTGTTTGAAATGCAACTGAAAAGCAAAGAAGTTCAAGCACTGATCAAAGTTAAAGATGCAAAGAAGTTTGATTTGCTCCTTCTAGAAGCATGCATTAGACCAGCAATTATTTTAACGCACGTTTTCGATGCACCAGCAATCCTTGTCAGTTCATTTGGAGGTGTGGAATATGTGTTTCGTATACTTGGCGTCCCAACGCATCCTGTACTATACCCGCCTCCGCTGCACCAAAGAATTTTTAATTTGACATTTTGGGAGAAAACGCACGAAATTTTTACTCATTACTATTTGGAATATCTTTTTTGGAAGGCAGAATATAAGGTCGATGAAATGGTAAAAAGGATTTTCGGACCCAGCACTCCAACTGTGAGAGATACCTATAAAAATGTAGAGATGATACTCTTGAATGCGTATGCTGTTTGGGAGAATAATAGACCTGTCCCTCCTAATGTCATATACGTTGGTGGCTTACATCAGAAACCAGAGAAGGATTTACCCGGGGATTTGAAAGAATATTTAGATTCTTCAAAACACGGCGTTGTATACATCAGTTTCGGCACAAACGTGGAACCATCGCTGCTGCCTCCAGAACGGATTCAACTCCTCATCAAAGTATTCTCCGAGCTGCCTTACGATGTACTCTGGAAATGGGACCAAGATGAATTGCCGGGCAAATCGGAAAACATCAAAATAGCAAAGTGGCTGCCACAATCAGATTTACTAAGGCATCCAAAGATCAAGGTGTTTATAACTCAAGGAGGTCTGCAATCGACCGAAGAGGCAATCACAGCTGGAGTGCCACTGATAGGGATACCTATGTTGATGGATCAATGGTACAATGTAGAGAAATACGTTCAGCTAAACATTGGCTTGAAACTCGATTTGGGCTCCATTACAGAGGATTCTTTCAGAAATGCTATCAACACAGTTACTGGTGATGAAAGCTATCGTCAGAACGTAGCTCGTCTCCGTAGCCAGGTCTTCGACCAGCCCCAGGGCCCTCTTGAGCGCGCCGTGTGGTGGACTGAGCACGTACTGCGCCACGGAGGGGCCACTCATCTCCGAGCCGCAGGAGCCCTGAAATCTTGGACTGAATATTTTGAACTAAATTTAATTGCAGTATTATTATTATAA
Protein
MLLITILQGTKAARILGVFPTPSISHQVVFRRLTLELHKRGHELVIVTTDPMYQKGEAPQNYTEIDVHDISYTTWRNDFMKLSRGSSDDLFEQSAVILELTTNLFEMQLKSKEVQALIKVKDAKKFDLLLLEACIRPAIILTHVFDAPAILVSSFGGVEYVFRILGVPTHPVLYPPPLHQRIFNLTFWEKTHEIFTHYYLEYLFWKAEYKVDEMVKRIFGPSTPTVRDTYKNVEMILLNAYAVWENNRPVPPNVIYVGGLHQKPEKDLPGDLKEYLDSSKHGVVYISFGTNVEPSLLPPERIQLLIKVFSELPYDVLWKWDQDELPGKSENIKIAKWLPQSDLLRHPKIKVFITQGGLQSTEEAITAGVPLIGIPMLMDQWYNVEKYVQLNIGLKLDLGSITEDSFRNAINTVTGDESYRQNVARLRSQVFDQPQGPLERAVWWTEHVLRHGGATHLRAAGALKSWTEYFELNLIAVLLL

Summary

Catalytic Activity
glucuronate acceptor + UDP-alpha-D-glucuronate = acceptor beta-D-glucuronoside + H(+) + UDP
Similarity
Belongs to the UDP-glycosyltransferase family.
Feature
chain  UDP-glucuronosyltransferase
EC Number
2.4.1.17
EMBL
HQ833816    ADY17534.1    JQ070229    AEW43145.1    BABH01029271    JQ070233    + More
AEW43149.1    DQ443275    ABF51364.1    BABH01029273    BABH01029274    JQ070232    AEW43148.1    JQ070236    AEW43152.1    FJ418685    ACJ48963.1    JQ070231    AEW43147.1    JQ070235    AEW43151.1    JQ070234    AEW43150.1    BABH01029259    BABH01029260    BABH01029272    JQ070230    AEW43146.1    BABH01029269    BABH01029270    ODYU01006890    SOQ49139.1    KZ150193    PZC72373.1    JQ070200    AEW43116.1    KU680280    ANI21986.1    KZ150360    PZC71200.1    ODYU01004485    SOQ44409.1    JQ747500    AGG36457.1    JQ070196    AEW43112.1    NWSH01005967    PCG63789.1    PZC71196.1    JQ070202    AEW43118.1    ODYU01010933    SOQ56350.1    KU680282    ANI21988.1    KU680284    ANI21990.1    KF777109    AHY99680.1    PZC71193.1    JQ070194    AEW43110.1    PZC71189.1    KF777111    AHY99682.1    PZC71195.1    PZC71192.1    PZC71199.1    KU680287    ANI21993.1    KU680281    ANI21987.1    KU680289    ANI21995.1    ODYU01004546    SOQ44548.1    JQ070193    AEW43109.1    KY202933    AUC64277.1    JQ070190    AEW43106.1    GEYN01000079    JAV02050.1    JQ070197    AEW43113.1    ODYU01005543    SOQ46493.1    PZC71194.1    KQ459547    KPJ00043.1    JQ070189    AEW43105.1    JTDY01001352    KOB74102.1    PZC71190.1    PZC71197.1    PZC71191.1    JQ070198    AEW43114.1    KU680290    ANI21996.1    JQ070195    AEW43111.1    KZ150704    PZC70375.1    KY202945    AUC64289.1    PZC71202.1    JQ070204    AEW43120.1    PZC70374.1    PZC71201.1    JQ070199    AEW43115.1    JQ070238    AEW43154.1    KZ149974    PZC75964.1    NWSH01000435    PCG76447.1    KF777110    AHY99681.1    JQ070201    AEW43117.1    KPJ00048.1    KU680288    ANI21994.1    KF777112    AHY99683.1    JQ070192    AEW43108.1    PZC72369.1    KU214506    AMK97472.1    KQ459937    KPJ19195.1    PZC72371.1    PZC71198.1    KY304474    AUN86405.1    PZC72370.1    KU680286    ANI21992.1    JQ070191    AEW43107.1    KU680283    ANI21989.1    KPJ00041.1    SOQ44549.1    ODYU01010294    SOQ55304.1    KU680285    ANI21991.1    ODYU01001030    SOQ36683.1    KU680291    ANI21997.1    KPJ00042.1    PZC72372.1    JQ070203    AEW43119.1    GEYN01000099    JAV02030.1    KQ459680    KPJ20473.1    KPJ00052.1    AGBW02009962    OWR49474.1    GQ915324    ACZ97418.2    KQ460636    KPJ13397.1    JQ070237    AEW43153.1   
Pfam
PF00201   UDPGT
Interpro
IPR035595   UDP_glycos_trans_CS        + More
IPR002213   UDP_glucos_trans       
IPR006326   UDPGT_MGT       
PDB
2O6L     E-value=5.82856e-25,     Score=284

Ontologies

Topology

Subcellular location
Membrane  
Length:
480
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.255279999999999
Exp number, first 60 AAs:
0.18212
Total prob of N-in:
0.01298
outside
1  -  480
 
 

Population Genetic Test Statistics

Pi
242.080138
Theta
152.16595
Tajima's D
1.037207
CLR
1321.878681
CSRT
0.667566621668917
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号