SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16418
Pre Gene Modal
BGIBMGA013833
Annotation
UDP-glycosyltransferase_UGT33D3_[Bombyx_mori]
Full name
UDP-glucuronosyltransferase      
Location in the cell
Cytoplasmic   Reliability : 1.879 Mitochondrial   Reliability : 1.482
 

Sequence

CDS
ATGCCTTCAATTAGTCATCAAGTGGTCTTTCGTTCTTTGACACTGGAGCTGGCGAAAAGAGGCCACGAGCTTGTCGTTCTCACGACTGATCCTGTCTTTCATAAGGGAACCTCACCAGGAAACTACACAGAAATAGATGTCCACGACAACTCCTACCAAATATGGAGAAACAGTTTCCTTCAAACATCAAAAGGCAAACTTCAAGATCGCTTTGAAGAGGCCAGACTAGTAGTGGACGTAATACATCAGTTGTTTATCAAACAATTGTTAACGGATGAGTTTCAAGAAATATTGAGAAGCAAAAAGAAATTCGATTTGGTAATTCTAGAGGCCATGATGAAACCAGCTAGAGTGCTTTGTCACGTGTTCAATGCACCTGCTGTAATCATAAGTTCCTTGGGAGGTATCGGAGATATTTACGACATTGTTGGAGCCCCAACCCATCCGTTATTGTATCCAGTATGGATACGTCGAAGGCTGCATAATCTGTCTTTCTGGGAGAAATTGAGCGAATTATACAATCATTATACCTTCGAACGCTTGTGGAATGAACTGGAGGAGAAAGATAATGAGCTGGTCCAGAGTGCGTTTGGGATTAATATGCCAAAACTAAATGATATGGTGGATAATATCAGTTTGATTCTGTTGAACGTACATCCGATTTGGGAACACAATCGTCCGGTTCCACCGAATCTTATTTATATTGGAGGTATTCATCAGAAGCCACAAAAGGCATTGCCTTCGGATCTTAAAACGTATTTAGACTCGTCCAAACACGGGGTAATTTACATCAGTTTTGGTACGAACGTGATACCTTCGCTGTTGTCGCCAGAACGAATCCAAGTCCTGATCAAAGTGTTCTCCCAACTGCCCTACGATGTGCTGTGGAAGTGGGATAAAGATGAGCTGCCGGGAAAGTCGAAAAATATCAGGACTTCGAAGTGGCTGCCACAATCTGATCTGCTTAGGCACCCGAAGGTTAAGCTTTTTATAACCCAAGGTGGTCTGCAGTCTACGGAAGAAGCGATCACCGCTGGAGTGCCACTGATTGGAATGCCGATGTTAGGAGATCAGTGGTACAACGTGGAACTTTACGTATTCCATAAAATCGGAGTAAAACTTGACATGGACAAACTGTCTGAAGAGACACTCAGATATAGCATTCAAGAGGTCATTGGTGATGAAAGTTACCGTCAGAACATAGCTCGTCTTCGAACACAAGTGTATGATCAGCCTCAGAGCCCTTTGGAGCGCGCCGTGTGGTGGACGGAGTACGTGCTGCGTCACGGAGGAGCCAAGCATCTGCGAGCTGCCGGCGCCAATCTATCCTGGTCACAATATTTGGACTTAGAACTTACTTCAGCATTATTCATTACTTTTGATTTTACGTAG
Protein
MPSISHQVVFRSLTLELAKRGHELVVLTTDPVFHKGTSPGNYTEIDVHDNSYQIWRNSFLQTSKGKLQDRFEEARLVVDVIHQLFIKQLLTDEFQEILRSKKKFDLVILEAMMKPARVLCHVFNAPAVIISSLGGIGDIYDIVGAPTHPLLYPVWIRRRLHNLSFWEKLSELYNHYTFERLWNELEEKDNELVQSAFGINMPKLNDMVDNISLILLNVHPIWEHNRPVPPNLIYIGGIHQKPQKALPSDLKTYLDSSKHGVIYISFGTNVIPSLLSPERIQVLIKVFSQLPYDVLWKWDKDELPGKSKNIRTSKWLPQSDLLRHPKVKLFITQGGLQSTEEAITAGVPLIGMPMLGDQWYNVELYVFHKIGVKLDMDKLSEETLRYSIQEVIGDESYRQNIARLRTQVYDQPQSPLERAVWWTEYVLRHGGAKHLRAAGANLSWSQYLDLELTSALFITFDFT

Summary

Catalytic Activity
glucuronate acceptor + UDP-alpha-D-glucuronate = acceptor beta-D-glucuronoside + H(+) + UDP
Similarity
Belongs to the UDP-glycosyltransferase family.
Belongs to the peptidase S1 family.
Feature
chain  UDP-glucuronosyltransferase
EC Number
2.4.1.17
EMBL
JQ070231    AEW43147.1    BABH01029259    BABH01029260    JQ070235    AEW43151.1    + More
JQ070234    AEW43150.1    BABH01029273    BABH01029274    BABH01029271    JQ070236    AEW43152.1    FJ418685    ACJ48963.1    JQ070230    AEW43146.1    BABH01029269    BABH01029270    JQ070233    AEW43149.1    JQ070232    AEW43148.1    JQ070229    AEW43145.1    HQ833816    ADY17534.1    DQ443275    ABF51364.1    JQ747500    AGG36457.1    KZ150193    PZC72373.1    JQ070200    AEW43116.1    JTDY01001352    KOB74102.1    KU680289    ANI21995.1    ODYU01010933    SOQ56350.1    KU680281    ANI21987.1    JQ070202    AEW43118.1    KF777111    AHY99682.1    ODYU01005543    SOQ46493.1    KY202933    AUC64277.1    KU680288    ANI21994.1    NWSH01005967    PCG63789.1    GEYN01000079    JAV02050.1    KZ150360    PZC71189.1    ODYU01004546    SOQ44548.1    ODYU01004485    SOQ44409.1    KU680287    ANI21993.1    ODYU01006890    SOQ49139.1    KY304474    AUN86405.1    JQ070194    AEW43110.1    JQ070204    AEW43120.1    PZC71195.1    PZC71193.1    KF777112    AHY99683.1    PZC71199.1    KZ149974    PZC75964.1    KQ459547    KPJ00043.1    KU680284    ANI21990.1    JQ070190    AEW43106.1    PZC71201.1    JQ070195    AEW43111.1    PZC71190.1    PZC71192.1    ODYU01010294    SOQ55304.1    PZC71194.1    KZ150704    PZC70375.1    KF777109    AHY99680.1    KU680283    ANI21989.1    PZC70374.1    KU680282    ANI21988.1    JQ070197    AEW43113.1    JQ070189    AEW43105.1    PZC71191.1    JQ070199    AEW43115.1    JQ070193    AEW43109.1    PZC71197.1    KU680280    ANI21986.1    KPJ00048.1    JQ070196    AEW43112.1    KF777110    AHY99681.1    JQ070191    AEW43107.1    JQ070201    AEW43117.1    PZC71196.1    JQ070198    AEW43114.1    PZC71198.1    SOQ44549.1    PZC71202.1    PZC71200.1    PZC72371.1    JQ070238    AEW43154.1    NWSH01000435    PCG76447.1    KQ459937    KPJ19195.1    PZC72369.1    KU680286    ANI21992.1    JQ070192    AEW43108.1    KU214506    AMK97472.1    KY202945    AUC64289.1    PZC72370.1    KU680291    ANI21997.1    KU680285    ANI21991.1    KU680290    ANI21996.1    ODYU01001030    SOQ36683.1    KPJ00042.1    KPJ00041.1    JQ070237    AEW43153.1    PZC72372.1    JQ070203    AEW43119.1    GEYN01000099    JAV02030.1    BABH01029238    BABH01029239    BABH01029240    PCG76446.1    KQ459680    KPJ20473.1    GQ915324    ACZ97418.2    KPJ00055.1    KPJ00049.1   
Pfam
PF00201   UDPGT        + More
PF00089   Trypsin
Interpro
IPR002213   UDP_glucos_trans        + More
IPR035595   UDP_glycos_trans_CS       
IPR006326   UDPGT_MGT       
IPR033116   TRYPSIN_SER       
IPR001314   Peptidase_S1A       
IPR009003   Peptidase_S1_PA       
IPR001254   Trypsin_dom       
IPR018114   TRYPSIN_HIS       
SUPFAM
SSF50494   SSF50494       
PDB
2O6L     E-value=7.44255e-26,     Score=292

Ontologies

Topology

Subcellular location
Membrane  
Length:
463
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.791150000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.03592
outside
1  -  463
 
 

Population Genetic Test Statistics

Pi
206.546027
Theta
174.135189
Tajima's D
0.585516
CLR
116.362563
CSRT
0.539473026348683
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号