SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16413
Pre Gene Modal
BGIBMGA013836
Annotation
UDP-glycosyltransferase_UGT33K1_precursor_[Bombyx_mori]
Full name
UDP-glucuronosyltransferase      
Location in the cell
PlasmaMembrane   Reliability : 1.957
 

Sequence

CDS
ATGTGTTGGAAAGTAGAAAGTGCTAGAATTTTAGCTGTCGTCCCTACACCTTCGATCAGCCATCAAGTTGTGTTTCGACCTGTTACTCAAGAGCTGGCCAGAAGAGGACACCAAGTCACTGTCATCACAACTGACCCTGCGTTCCCAAAAGGTCAAACTCCGGACAATTTGACAGAAATCGATCTTCACGATTTGTCATACGGCCTTTGGTCGAGAATGTTCTTGAACATTACTCCGACTATTTCTAAAGTTGGTGCTTATGAAATGATGAAATCAGCCTACGAGTCGTTCAACGTGATATTCGAAAATCAAATGAATAGTGATGAGGTACAAAAAATACTAAACGATAGGAGGAAGGTATTCGATTTGCTGATTGTCGAAGCGTGTGTAAGACCAGCTCTAGTGCTCTCTTATAAATACAAAGTTCCATTAATATTATTCAGCTCGTTTGGCACTGTCCATGGTTCTTTAGAAGCTGTTACAGGACCGTTCCATGCCTTCTTGAATCCGGGCCAAATGCAAAGGAGAGTTCACAAATTGACCACGTGGGAGAAAATTAAAGAGATTTGGGTACAATATAAGTTCCAGAGAGTTTTAAAGGAATTAGAAGAGCCTGAGACGGAAATGGGAAGAAAGCTATTCGGTCCTGAGGTACCGCACATAACCGAGTTGATGAATAACGTGGATCTGTTGTTTTTAAACGTTCACGCTTCGTGGGACAACAATAGATCGGTACCACCGAGTTTAATATATTTGGGAGGTTTACCCCAAAAACCAGGCAAGGAGCTACCAAAGACCCTCAAATCCTATATGGACTCATCACGAAAAGGTATCATTTACATCAGTTTTGGTACGAACGTTTTGACCTCTCTGTTGCCCAAGGACAAAGTGAACGTTCTGTTTAGAGCAATCTCAGTTTTACCACACAACGTTATTTTGAAGTGGGACGCGGACAAAATGCCCGGACTTCCCGAGAACGTTTTAATGGGAAAATGGTTCCCGCAATCCGATTTATTAAAGCATCGAAATGTTAAATTATTCATAACCCAGGGAGGTCTCCAATCGACCGATGAATCCATAACAGCTGGAGTGCCGCTAATAGGCATACCGATGATAGGAGACCAGTGGTACAACGTTGAACAGTATGTCAAGTTTGGCATCGGCGTGGGCTTAGACCTGGAGTCCTTGACTAAGGCGGACCTGCTAGAAGCGATTCACAAAGTCATTGGTGATGAAAGCTACCGTCAAAACATAGCTTGTCTCCGGCGCCAGATGTACGACCAGCCCCAGAGCTCGTTGGAGCGCGCCGTGTGGTGGACTGAGTACGTGCTGCGTCACGGAGGAGCCAAGCATCTCCGTTCGCCAGCAGCCAATATGAGCTTGACCCAATACTTGGAGCTAGACCTATTATCCCTATTATTACTTCTAGTCTGTATCATCCTATTTGTAATCGGTTTAACAGTTTACAACATTGGGAACTTTTTAAGGATTACACAAAAAAATAAAATAAAAAGATATTGA
Protein
MCWKVESARILAVVPTPSISHQVVFRPVTQELARRGHQVTVITTDPAFPKGQTPDNLTEIDLHDLSYGLWSRMFLNITPTISKVGAYEMMKSAYESFNVIFENQMNSDEVQKILNDRRKVFDLLIVEACVRPALVLSYKYKVPLILFSSFGTVHGSLEAVTGPFHAFLNPGQMQRRVHKLTTWEKIKEIWVQYKFQRVLKELEEPETEMGRKLFGPEVPHITELMNNVDLLFLNVHASWDNNRSVPPSLIYLGGLPQKPGKELPKTLKSYMDSSRKGIIYISFGTNVLTSLLPKDKVNVLFRAISVLPHNVILKWDADKMPGLPENVLMGKWFPQSDLLKHRNVKLFITQGGLQSTDESITAGVPLIGIPMIGDQWYNVEQYVKFGIGVGLDLESLTKADLLEAIHKVIGDESYRQNIACLRRQMYDQPQSSLERAVWWTEYVLRHGGAKHLRSPAANMSLTQYLELDLLSLLLLLVCIILFVIGLTVYNIGNFLRITQKNKIKRY

Summary

Catalytic Activity
glucuronate acceptor + UDP-alpha-D-glucuronate = acceptor beta-D-glucuronoside + H(+) + UDP
Similarity
Belongs to the UDP-glycosyltransferase family.
Belongs to the peptidase S1 family.
Feature
chain  UDP-glucuronosyltransferase
EC Number
2.4.1.17
EMBL
JQ070237    AEW43153.1    BABH01029238    BABH01029239    BABH01029240    KZ150360    + More
PZC71193.1    JQ070194    AEW43110.1    JQ070238    AEW43154.1    KU680281    ANI21987.1    KU680282    ANI21988.1    KF777109    AHY99680.1    PZC71195.1    JQ747500    AGG36457.1    JQ070200    AEW43116.1    KZ150193    PZC72373.1    ODYU01006890    SOQ49139.1    JQ070197    AEW43113.1    JQ070193    AEW43109.1    KU680283    ANI21989.1    ODYU01004485    SOQ44409.1    PZC71192.1    KU680289    ANI21995.1    PZC71196.1    PZC71197.1    PZC71200.1    PZC71201.1    JQ070196    AEW43112.1    PZC71191.1    JQ070195    AEW43111.1    JQ070189    AEW43105.1    KU680280    ANI21986.1    ODYU01010933    SOQ56350.1    JQ070199    AEW43115.1    PZC71202.1    KZ150704    PZC70375.1    JQ070198    AEW43114.1    PZC71199.1    FJ418685    ACJ48963.1    BABH01029271    JQ070236    AEW43152.1    JQ070190    AEW43106.1    KU680288    ANI21994.1    PZC71190.1    ODYU01004546    SOQ44549.1    PZC70374.1    KU680284    ANI21990.1    JQ070201    AEW43117.1    NWSH01000435    PCG76447.1    PZC71194.1    NWSH01005967    PCG63789.1    PZC71198.1    JQ070202    AEW43118.1    PZC71189.1    KQ459937    KPJ19195.1    PZC72370.1    KF777111    AHY99682.1    PZC72371.1    KY202945    AUC64289.1    KU214506    AMK97472.1    KF777110    AHY99681.1    BABH01029259    BABH01029260    JQ070231    AEW43147.1    JQ070191    AEW43107.1    JQ070192    AEW43108.1    JQ070234    AEW43150.1    KU680287    ANI21993.1    JQ070235    AEW43151.1    JQ070233    AEW43149.1    KQ459547    KPJ00048.1    KY304474    AUN86405.1    KU680285    ANI21991.1    PZC72369.1    KF777112    AHY99683.1    KY202933    AUC64277.1    JQ070203    AEW43119.1    GEYN01000079    JAV02050.1    PZC72372.1    ODYU01010294    SOQ55304.1    SOQ44548.1    ODYU01001030    SOQ36683.1    KU680286    ANI21992.1    DQ443275    ABF51364.1    JQ070232    AEW43148.1    KU680291    ANI21997.1    JQ070229    AEW43145.1    BABH01029273    BABH01029274    JQ070230    AEW43146.1    HQ833816    ADY17534.1    JQ070204    AEW43120.1    KZ149974    PZC75964.1    BABH01029269    BABH01029270    PCG76446.1    ODYU01005543    SOQ46493.1    KPJ00043.1    KU680290    ANI21996.1    KPJ00042.1    JTDY01001352    KOB74102.1    KPJ00041.1    JTDY01001195    KOB74582.1    GEYN01000099    JAV02030.1    KPJ00054.1    KPJ00045.1    GQ915324    ACZ97418.2    KPJ00052.1   
Pfam
PF00201   UDPGT        + More
PF00089   Trypsin
Interpro
IPR002213   UDP_glucos_trans        + More
IPR035595   UDP_glycos_trans_CS       
IPR033116   TRYPSIN_SER       
IPR001314   Peptidase_S1A       
IPR009003   Peptidase_S1_PA       
IPR001254   Trypsin_dom       
IPR018114   TRYPSIN_HIS       
IPR006326   UDPGT_MGT       
SUPFAM
SSF50494   SSF50494       
PDB
2O6L     E-value=2.77399e-25,     Score=287

Ontologies

Topology

Subcellular location
Membrane  
Length:
506
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.79132
Exp number, first 60 AAs:
0.07832
Total prob of N-in:
0.04242
outside
1  -  468
TMhelix
469  -  491
inside
492  -  506
 
 

Population Genetic Test Statistics

Pi
162.261218
Theta
160.849691
Tajima's D
0.857339
CLR
0
CSRT
0.621568921553922
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号