SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16410
Pre Gene Modal
BGIBMGA012392
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Diaphorina_citri]
Location in the cell
Cytoplasmic   Reliability : 2.01
 

Sequence

CDS
ATGCTAGAGACAGATGAGTATGCTGGTCGATTTAGGGAAATAATGATAGAAAACATCTTGGAAATGAAGGATATGAAAGAGAAATCTGCGAATGATTGTTGGGATGAAATGGCAAATAGTGTCAGGAAGACAGCTAAGGCTGTGCTCGGCGAATCAAAAGGGAAAGGTATAATTGACAAGGATACATGGTGGTGGAATGAGAATGTACAGAGAGAATTGAAAGAAAAGAAGAATGCATTCAAAAAGTGGCAACTAGAGAGAGGTAATGAAAGTGAGAGGCAAGCTAGGAAGAATGAGTATAGAGAATGTAAGAAAAAGGCCACTAAAGCAGTTGCTATAGCCAGGTCTGACGCTCAGAAACGGTTGTATGCCGCTTTAGATGGACCTCGTGGACAAAAGGAACTTTACCGTATTACAAGAGCTAGAGAAGAAAGAGCGAAAGATATTAAGCATGTCAGATGTATGAAAAATGAGACAGGTAAAGTTTTAATGAGAGATGACGAAATAAAAGAGCGCTGGAAGATATATTTTGAAAAATTAATGAATGAGGAGAACGACTGGAATAGAGTGATTAATAGGAAGCCAGAGAACGTCGGACTTGTGAATGAGATTAGTATGTATGAAGTTAGAGAAGCAGTGAGAAGTATGAAAAGCGGAAAATCGGAAGGACCAGACGGTATACCAGTGGAAGTATGGAAGATACTGGGAGAAGACGGATATAAGTGGCTGACTTTATTCTTCAATAAGCTGCTGCAAGAAGAAGTGATCCCTACGGAATGGAGCATCAGTACGCTGGTGCCCATATACAAAAATAAAGGGGATGTGCAAGACTGTGGCAGCTATCGGGGAATAAAGCTTATGTCTCATAGTATGAAAGTTTGGGAGAAAGTGATAGAAAAGCGATTGCGAGATGAAAGTGAGATCACCCAAAACCAGTTCGGGTTCATGCCTGGTCGCGGGACAACGGACGCCATATTTGCACTCCGCCAAGTGTGCGAAAAACATCGCGACGTGCACAGGAATCTGCATATGGTGTTCGTTGATCTAGAGAAAGCGTACGACCGAGTACCTAGAGCAGTTTTGTGGTGGGCATTGAATGAGAAAGGTATACCTGGTAAGTATGTGAGGTTAATCTGTGCCATGTACAGTCGAGCCAGGACGTATGTACGAACCGCCGCGGGGAATTCCGACGAGTTCAATGTGGCAGTGGGCTTACACCAAAGGTCTGCACTAAGTCCCTATCTCTTCCTGCTTGTGATGGATGCCTTGACATCGGAGATACAGGAAGAGCCCCCTTGGTGTATGCTGTTTGCCGATGACATAGTGCTCGTCGGAGAAAACGGGCTCGAGGTCCAAAACATACTGGAGAAATGGCGATGCAAGTTGGAGAGTGTTGGCCTAAAAATCAGCAGATCGAAAACCGAACATCTGTTCTGTGATTTTGGCGGTCTCTCCAATTTTGCACCCATTTCCCTCGACGGAACACCTTTGCCAGTATGTCAAGACTTCCGCTACCTAGGGTCTGTTATCCAAAGCGACGGTGAACTGGATCGTACTGTCAGGCACAGAATTGACGCAGGATGGATGAAATGGCGGCAGGTCACGGGCACCATATGTGACTCGCACATCCCTCTTCCCCTAAAAGGGAAGATATATAAGACCTTAATAAGGCCTGCCGTCTTGTATGGATCAGCGTGTTGGACAACGAAAGTGGCGGATGAAAGGCGATTGCATGCAGCAGAGATGCGAATGTTGCGATGGATGTGTGGAGTAACGAGAATGGATAGAATACGGAATGAATATGTTAGAGGAAGTCTGAAAGTGGCACCTGTGACTGAGAAGCTGAGGAGTGCACGTTTGGGATGGTATGGACATGTGATGAGACGGAATGAAAATGAGGTTGTTAAGAGAGTGTTAACTATGAATGTGGAAGGATTTAGAGGAAGAGGTAGACCTAAGAAGAAATGGATGGATTGTGTGAAAGACGATATGGGTAGGAGGGGAGTGAGCGAAGAAATGGTATATGATAGAAGAGTATGGAAGGAGAAAACATGTTGCGCCGACCCCAGGTAA
Protein
MLETDEYAGRFREIMIENILEMKDMKEKSANDCWDEMANSVRKTAKAVLGESKGKGIIDKDTWWWNENVQRELKEKKNAFKKWQLERGNESERQARKNEYRECKKKATKAVAIARSDAQKRLYAALDGPRGQKELYRITRAREERAKDIKHVRCMKNETGKVLMRDDEIKERWKIYFEKLMNEENDWNRVINRKPENVGLVNEISMYEVREAVRSMKSGKSEGPDGIPVEVWKILGEDGYKWLTLFFNKLLQEEVIPTEWSISTLVPIYKNKGDVQDCGSYRGIKLMSHSMKVWEKVIEKRLRDESEITQNQFGFMPGRGTTDAIFALRQVCEKHRDVHRNLHMVFVDLEKAYDRVPRAVLWWALNEKGIPGKYVRLICAMYSRARTYVRTAAGNSDEFNVAVGLHQRSALSPYLFLLVMDALTSEIQEEPPWCMLFADDIVLVGENGLEVQNILEKWRCKLESVGLKISRSKTEHLFCDFGGLSNFAPISLDGTPLPVCQDFRYLGSVIQSDGELDRTVRHRIDAGWMKWRQVTGTICDSHIPLPLKGKIYKTLIRPAVLYGSACWTTKVADERRLHAAEMRMLRWMCGVTRMDRIRNEYVRGSLKVAPVTEKLRSARLGWYGHVMRRNENEVVKRVLTMNVEGFRGRGRPKKKWMDCVKDDMGRRGVSEEMVYDRRVWKEKTCCADPR

Summary

Uniprot
A0A2A4IZ11   A0A1D6MK44   A0A3L6FHK1   A0A3L6DEY6   A0A317YB76   A0A1D6M7A6   + More
A0A1D6HX90   A0A1D6GGM3   A0A1D6MYV7   A0A1D6KLY6   A0A1D6JQ10   A0A1D6LFI2   A0A1D6LXZ4   A0A1D6KX85   A0A1D6I7A1   A0A3L6FAM2   A0A1D6K3M7   A0A1D6PU65   A0A1D6FJU8   A0A3L6GA57   A0A1D6NCE0   A0A1D6I351   A0A151QVZ1   A0A3L6G913   A0A3L6EF28   A0A1D6I601   A0A1D6JJN9   A0A3L6DTJ3   A0A1D6G503   A0A317Y223   A0A1D6KVT7   A0A1D6I607   A0A1D6J5H5   A0A317Y8S7   A0A1D6P0V1   A0A1D6MV72   A0A1D6LC02   A0A1D6KWI6   A0A1D6JIM9   A0A1D6GRX4   A0A1D6HE72   A0A317Y9W4   A0A3P9IMA9   A0A3B3HS69   A0A0V0IX54   A0A3B3BCY6   A0A3P9J281   A0A3B3HPR4   A0A3B3IEV4   A0A3P9KEZ0   A0A3B3HT45   A0A3B3H692   A0A3B3HJZ3   A0A3B3I8S7   A0A3Q1JGK5   A0A3B3CTC7   A0A3B3B9G5   A0A3B3C7H7   A0A3P9M3S5   A0A3B3CCF8   A0A3B3BTI6   A0A3B3IP13   A0A3B3HQU7   A0A3P9M4S0   A0A3B3HKV3   A0A3B3IAI6   A0A3B3IM62   A0A3B3HGI6   A0A3B3H3Q1   A0A3B3HLA9   A0A3B3HFD6   A0A3P9H8X2   A0A3B3HNW5   A0A3B3HUW2   A0A3P9MAU2   A0A3B3HP42   A0A3B3IC09   A0A3B3HPV6   A0A3P9K813   A0A3B3IC33   A0A3P9HVA4   A0A3P9MI82   A0A3B3HV05   A0A3P9H708   A0A3B3HSD0   A0A3P9K1J1   A0A3B3HYL2   A0A3P9LF91   A0A3P9GYE2   A0A3P9MJS1   A0A3P9JLZ1   A0A3B3HB06   A0A3B3IFA0   A0A3B3H2V1   A0A3P9H4S8   A0A3P9JXW8   A0A3B3HFM9   A0A3B3IMV3   A0A3B3H977   A0A3B3I9A4  
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF04937   DUF659
PF14529   Exo_endo_phos_2
PF01300   Sua5_yciO_yrdC
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036882   Alba-like_dom_sf       
IPR027124   Swc5/CFDP2       
IPR007021   DUF659       
IPR012337   RNaseH-like_sf       
IPR017945   DHBP_synth_RibB-like_a/b_dom       
IPR006070   YrdC-like_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF82704   SSF82704       
SSF53098   SSF53098       
SSF55821   SSF55821       
Gene 3D
ProteinModelPortal
A0A2A4IZ11   A0A1D6MK44   A0A3L6FHK1   A0A3L6DEY6   A0A317YB76   A0A1D6M7A6   + More
A0A1D6HX90   A0A1D6GGM3   A0A1D6MYV7   A0A1D6KLY6   A0A1D6JQ10   A0A1D6LFI2   A0A1D6LXZ4   A0A1D6KX85   A0A1D6I7A1   A0A3L6FAM2   A0A1D6K3M7   A0A1D6PU65   A0A1D6FJU8   A0A3L6GA57   A0A1D6NCE0   A0A1D6I351   A0A151QVZ1   A0A3L6G913   A0A3L6EF28   A0A1D6I601   A0A1D6JJN9   A0A3L6DTJ3   A0A1D6G503   A0A317Y223   A0A1D6KVT7   A0A1D6I607   A0A1D6J5H5   A0A317Y8S7   A0A1D6P0V1   A0A1D6MV72   A0A1D6LC02   A0A1D6KWI6   A0A1D6JIM9   A0A1D6GRX4   A0A1D6HE72   A0A317Y9W4   A0A3P9IMA9   A0A3B3HS69   A0A0V0IX54   A0A3B3BCY6   A0A3P9J281   A0A3B3HPR4   A0A3B3IEV4   A0A3P9KEZ0   A0A3B3HT45   A0A3B3H692   A0A3B3HJZ3   A0A3B3I8S7   A0A3Q1JGK5   A0A3B3CTC7   A0A3B3B9G5   A0A3B3C7H7   A0A3P9M3S5   A0A3B3CCF8   A0A3B3BTI6   A0A3B3IP13   A0A3B3HQU7   A0A3P9M4S0   A0A3B3HKV3   A0A3B3IAI6   A0A3B3IM62   A0A3B3HGI6   A0A3B3H3Q1   A0A3B3HLA9   A0A3B3HFD6   A0A3P9H8X2   A0A3B3HNW5   A0A3B3HUW2   A0A3P9MAU2   A0A3B3HP42   A0A3B3IC09   A0A3B3HPV6   A0A3P9K813   A0A3B3IC33   A0A3P9HVA4   A0A3P9MI82   A0A3B3HV05   A0A3P9H708   A0A3B3HSD0   A0A3P9K1J1   A0A3B3HYL2   A0A3P9LF91   A0A3P9GYE2   A0A3P9MJS1   A0A3P9JLZ1   A0A3B3HB06   A0A3B3IFA0   A0A3B3H2V1   A0A3P9H4S8   A0A3P9JXW8   A0A3B3HFM9   A0A3B3IMV3   A0A3B3H977   A0A3B3I9A4  
PDB
6AR3     E-value=0.0045622,     Score=97

Ontologies

Topology

Length:
690
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00111
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00026
outside
1  -  690
 
 

Population Genetic Test Statistics

Pi
239.301664
Theta
39.514243
Tajima's D
3.530264
CLR
105.449703
CSRT
0.994800259987001
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号