SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16404
Annotation
PREDICTED:_uncharacterized_protein_LOC105842415_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.448
 

Sequence

CDS
ATGAGTGAGAAAGAAGAAAAGGAGTTAGTTAAAAAACGAGCTAGTCTAAAAGGCCGATTGACTACATTCAGAAAGTACATCGAGGAATTGAGCGGTACGTTGAATCAGCAACAAGTAAATGAATTGCAATTAAGAATCGGTAAGATCGAATTATTATTTGAACAATATGACGTAGTACAAACTAAAATAGAATGCCTCGCTGACGATTTCAGCTCGCAAAGCACAGAGAGAGAAGATTTCGAATCGATTTATTACAAATCCCTTTCACAGGCTCAGGAGATTCTTTCTCGTAATTCTAAATTGTTACAAACCGATGCGCATAGTTTTGAGAGTTGTTCTCATGTGAGCAATCATCGCCTGGTTAAATTACCTACCATTAACCTACCCAAATTTAATGGTTCATATAACAATTGGCTGGAATTCCATGACACCTTCAGTAGTCTTATACATTCGAACGAGGCGATAGGAGAAATTAATAAATTCCACTACCTCAGGGCCTCGCTAGGAGGCTCTGCTGCTGTACTACTTCAGGAGATTCAGTTCTCTGCCAGCAACTATTCTGTGGCGTGGAAGCTGTTATGTGAGAGGTACGATAATAAGCGCCTATTAATTCAAACACATGTTAATAATTTATTTAATATAGACGCAATAAAGAGTGAATCTTCGTTTAGTTTAAGACGTTTCATAGATCAGCTGAATAAAAGCCTGAGAGCTTTAGAGTCGCTGGGCGAACCGACTGATCATTGGGACACTCTTCTCATCCACATGATGAGTCGTAAAATCGAACAGAAGACGCTGCGTGAATGGGAAGAGTGCAAAGGTCGTCTTGATAAAGAAAAGCCCATTTCTTTGTCCATATTTCTCGATTTCATTCGTAACCGGGCCGATCTATTAGAAACGATGGAATTTACTCGCCCTAACCTTCCTCACACACAAGTTCAGCCACCACAGTCACCTAAAGGTCAGAAAATTAAAACATTAGTTTCTGTCTCCGGAACGCAGCCGTCGTCGAGTGGCGGCGCTAGTATTATTTCTGGTTCCGGTACAGCATCGTGCCCACACTGTAAGGGTGAGCATTATCTTTATAATTGCGATAAATTTCTGAGCCTTAATAGTGAGCAGAGATGGGAATTAATTCCTCAGCTCAAGGTGTGTTACAACTGCTTTCGTAGTGGTCATTATTCGAATCGCTGCAGAAAAGGTGGTTGTACTTTATGTAAGCTTAGGCATAATATGCTGCTGCACACCTCTTCTAATAATAAACAGGGAATTAATCACCCCGCTCCTAAGCGTGACACCGCGGCAATCGCCTCCGCCATCCAGCCTGAACCTCCTGGTAACCACGGCCTAACGTTAGCCATGTATTCTGCCGCCGCACCTTCAGAGATTAGTAAAGATGGTATGTTTGCGACGGCTCTCGTTAAAGTTGTCGATAGTAATGGTCACGAGCACATCATACGTGCTCTTCTGGATTGTGCGAGTTCGTCTTGCATCATTAGTGAGAAAACTGGTCGCTTATTGAATGCCAAGTATATTGATATAGATAAACCTATTTTCGGCATCGATAAGACTAGAACTAACACTTCAAAAATGTGTTATGTTTCTTTCAGTTCACGCACTGAAAATTATTCCAAATGTCTTCTTTGTTATGTATTGCCGTCCATAACTGATGACGTGCCTTGCCATTCATTTGATGTTTCGCATTTAAATATTCCCGCTAATATTATTTTAGCTGATCCCCAATTTTATAGGGCGTCAGAAATTGACATGATAATTGGATCTAATATCTTTTGGGATCTGCTCGGGACGCCAAAGATCAATCTGGGAGATAACATCTCTATCCTCTGGGAAACTCGACTTGGCTGGTTGGTGGTTTCCGGGGATCTAAGTGATGGTCATGGATATGCTCCCCTAATGTGCAACTTTACAAAACTTACAGACATTTCTCAAGATCTTGATCTCGGCGTTGATGACACTCAGAACTTGCTTTCGCGGTTCTGGCAGCCGAAGGAAGTCGGCCTTAAGTCATCATACTCCGAGGAGGAACGAAAATGTGAAGAACATTTCGTTAAAAATACGAAACGTCTAGCTGATGGTTGTTTTCCTATCGGCCTTGAATGCAGTGACAAGAACATCTCAGAGATCATCATTCACGACTTCTACGTGAATGATCTGCTCACGGGGTCTGACTCATTTCAGGAGGCGTTGGACATTAAGAAGAAAGTTGCCGCCGCAGAGCTAGCCTCCGCCAGGATGCCTCTGCGCAAGTGGAAGTCCAACGATCCTCTACTCTGTCTTACTAGTGATCCGTGCGACGATAATGCGTCGCAAAGCGCCTATCGTGCTTGCCTTTACGCGCGAAGCGCGAACGTGTATGGACGAATCAAGGTCTCGTTACTTATGGCCAAGAGGAAGGTGGCTGCATTAAAGCCAACTACGATCCCTCGGTTGGAGCTCTGTGGGGCTCTGGTAGGAGTGCGCCTCTACGAGAAGGCTATTGATTCGCTCCGGGTTCAGGTCAGGCATACTACTTTTTGGACTGACTCGACGATTGTGTTAGGCTGGCTTAAAATGTTGCCTAGTAAATTACAGCCTTTCGTTCGCAATCGTACGGTGGAGATCATGGAGAATCCAGACTCCCTGAAGTTCGTCCTGAAGTCTCGTTACACCTTTCAGTTCCACGTGATGATTCATTTATTGATTTCAGCCGATTCTCAAACCTATCTCGACTAA
Protein
MSEKEEKELVKKRASLKGRLTTFRKYIEELSGTLNQQQVNELQLRIGKIELLFEQYDVVQTKIECLADDFSSQSTEREDFESIYYKSLSQAQEILSRNSKLLQTDAHSFESCSHVSNHRLVKLPTINLPKFNGSYNNWLEFHDTFSSLIHSNEAIGEINKFHYLRASLGGSAAVLLQEIQFSASNYSVAWKLLCERYDNKRLLIQTHVNNLFNIDAIKSESSFSLRRFIDQLNKSLRALESLGEPTDHWDTLLIHMMSRKIEQKTLREWEECKGRLDKEKPISLSIFLDFIRNRADLLETMEFTRPNLPHTQVQPPQSPKGQKIKTLVSVSGTQPSSSGGASIISGSGTASCPHCKGEHYLYNCDKFLSLNSEQRWELIPQLKVCYNCFRSGHYSNRCRKGGCTLCKLRHNMLLHTSSNNKQGINHPAPKRDTAAIASAIQPEPPGNHGLTLAMYSAAAPSEISKDGMFATALVKVVDSNGHEHIIRALLDCASSSCIISEKTGRLLNAKYIDIDKPIFGIDKTRTNTSKMCYVSFSSRTENYSKCLLCYVLPSITDDVPCHSFDVSHLNIPANIILADPQFYRASEIDMIIGSNIFWDLLGTPKINLGDNISILWETRLGWLVVSGDLSDGHGYAPLMCNFTKLTDISQDLDLGVDDTQNLLSRFWQPKEVGLKSSYSEEERKCEEHFVKNTKRLADGCFPIGLECSDKNISEIIIHDFYVNDLLTGSDSFQEALDIKKKVAAAELASARMPLRKWKSNDPLLCLTSDPCDDNASQSAYRACLYARSANVYGRIKVSLLMAKRKVAALKPTTIPRLELCGALVGVRLYEKAIDSLRVQVRHTTFWTDSTIVLGWLKMLPSKLQPFVRNRTVEIMENPDSLKFVLKSRYTFQFHVMIHLLISADSQTYLD

Summary

EMBL
NWSH01001945    PCG69607.1    KQ459312    KPJ01687.1    KQ460211    KPJ16510.1    + More
NWSH01001201    PCG72150.1    KQ460205    KPJ16960.1    GAIX01014054    JAA78506.1    KQ460500    KPJ14270.1    GALX01005110    JAB63356.1    KQ977963    KYM98425.1    GEZM01012999    JAV92824.1    KQ979276    KYN22031.1    GEZM01086715    JAV59020.1    KQ458793    KPJ04955.1    KQ460970    KPJ10166.1    KQ460545    KPJ14069.1    KQ977557    KYN02007.1    KQ977342    KYN03430.1    GBHO01005506    GBHO01005503    JAG38098.1    JAG38101.1    KQ979016    KYN24380.1    KQ981002    KYN10407.1    KQ973442    KXZ75531.1    ABLF02022040    ABLF02056888    KQ977081    KYN05932.1    KQ977691    KYN00577.1    GGMS01001896    MBY71099.1    GEHC01000870    JAV46775.1    GGMR01009911    MBY22530.1    GGMS01000724    MBY69927.1    GGMR01018506    MBY31125.1    GGMR01020322    MBY32941.1    GBBI01004140    JAC14572.1    GFTR01008874    JAW07552.1    GBBI01004139    JAC14573.1    GBGD01000063    JAC88826.1    ABLF02023723    ABLF02042806    GGMR01017803    MBY30422.1    GEHC01000869    JAV46776.1    ABLF02016109    ABLF02016113    ABLF02006001    ABLF02006002    LKEX01009637    KYN50127.1    ABLF02016099    KQ977311    KYN03597.1    GGMR01011015    MBY23634.1    ABLF02055387    GEHC01000939    JAV46706.1    ABLF02041599    GEHC01000864    JAV46781.1    ABLF02042264    ABLF02026305    GGMS01010815    MBY80018.1    GGMR01015704    MBY28323.1    ABLF02021176    ABLF02066403    ABLF02011452    GGMR01020500    MBY33119.1    ABLF02007122    ABLF02033517    GGMS01016389    MBY85592.1    ABLF02041590    GGMR01005292    MBY17911.1    GBBI01004032    JAC14680.1    ABLF02022912    ABLF02038819    ABLF02051942    ABLF02060282    ABLF02012925    ABLF02012929    ABLF02012930    ABLF02041519    ABLF02028302    ABLF02041631   
Pfam
PF03564   DUF1759        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF07679   I-set
Interpro
IPR036397   RNaseH_sf        + More
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR001878   Znf_CCHC       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR000477   RT_dom       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR013098   Ig_I-set       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF48726   SSF48726       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
910
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01958
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00016
outside
1  -  910
 
 

Population Genetic Test Statistics

Pi
454.032577
Theta
212.202871
Tajima's D
3.246799
CLR
0.033036
CSRT
0.988800559972001
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号