SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16386  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013738
Annotation
PREDICTED:_transmembrane_protease_serine_11A-like_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.285
 

Sequence

CDS
ATGTACAGCTTAAGCAAAGTTTTATTCCTCATTGGGATTTTAGTGTGTACGAATGCTAAAGATTATGATAAGCATTGGGCTTTCATTGGGAATCCACTTCTTCATGCAGCTCCGTGCATCGGAAACAGTAAAGTATCTATATCATATGAACCGGGCCTGGCACCGGAGGAAGAAACTAAATACAATTTATTTATAAACGGCCCTTTCCCCGAACACACGACAATCAAAATGAAATTTGATTCGCCCGCCAATGTGACTCTGAGCAACGACATAGGCAAATTAGCAAGAGTGTCTTCGTATGCTGACGGAATGTTCTTCATCAAATACTTTAAAGGCGGACCCTATTTCAGTGCAGATGTGATAGGTTTAAACTTATCCGTAGTACCTTACCCGACCACTATTAACTTAAACTTTGTCGAATACTGCGAGCACCCGGCACTTGGAATCTTAGATGGATATATCAACGGATATAAATCAACAGCTTCATCTACTTATACAGAACACGATGACAACTGTGGAAGAATTAAAATCTCCGAAAAACAATGCGGTGGAAACGAAGAAGAACCTATGCCCTGGCATGCTCTTATCAGAGACGACAACTCTACAATATGCGCTGGAACGTTGATATTACAGAGATATGTTTTGACAGCCGCTCAATGCGTCACAAACTTAGGCGTTGCGAAGAACGCCACAACTCTGTCTGTGGTTCTTGGGAAATTTAATAACACCAGTGATGAATGCTTACAGGAAATGGAGGTGGAAACAGTATTCGTTTACGATGGATACAATTATGAAAATGGAACAAATAACATTGCGTTGTTAGAACTGAAGAACGATGTGGTGTTTAACGAAAAAGTCCAACCTGCGTGTCTGTGGGAGTTCAGCGCATACAAGAAGTTAAATTTGAAAGACATCAAGGGATCTGTCATAAGCACAACTCTCGGCGATGATATTGATGAAGGTCTCGAGGTAGTGAATATGAAAAAGCTTAAGTCTTCTAAAGAAGTAAATGTTTATAGGGAGGAGAAATTTGGATCCAAATTCAACGCCACATCTATCAATCGTAAGTGGAACAATAAAGTTTATGGTAGCTGTCCGTCTACCCACGTGCTTTCAAAGGATTAA
Protein
MYSLSKVLFLIGILVCTNAKDYDKHWAFIGNPLLHAAPCIGNSKVSISYEPGLAPEEETKYNLFINGPFPEHTTIKMKFDSPANVTLSNDIGKLARVSSYADGMFFIKYFKGGPYFSADVIGLNLSVVPYPTTINLNFVEYCEHPALGILDGYINGYKSTASSTYTEHDDNCGRIKISEKQCGGNEEEPMPWHALIRDDNSTICAGTLILQRYVLTAAQCVTNLGVAKNATTLSVVLGKFNNTSDECLQEMEVETVFVYDGYNYENGTNNIALLELKNDVVFNEKVQPACLWEFSAYKKLNLKDIKGSVISTTLGDDIDEGLEVVNMKKLKSSKEVNVYREEKFGSKFNATSINRKWNNKVYGSCPSTHVLSKD

Summary

Similarity
Belongs to the peptidase S1 family.
Pfam
PF00089   Trypsin
Interpro
IPR001254   Trypsin_dom        + More
IPR009003   Peptidase_S1_PA       
IPR018114   TRYPSIN_HIS       
IPR001314   Peptidase_S1A       
IPR033116   TRYPSIN_SER       
SUPFAM
SSF50494   SSF50494       
PDB
5JPM     E-value=8.51458e-10,     Score=152

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.989727
 
 
Length:
374
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04856
Exp number, first 60 AAs:
0.02343
Total prob of N-in:
0.00363
outside
1  -  374
 
 

Population Genetic Test Statistics

Pi
413.364018
Theta
173.558005
Tajima's D
3.949325
CLR
0.280743
CSRT
0.998800059997
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 STASPTAPGGISQGNIAAIAK 100.00 7e-05
29197581 IVGSGFMVFVPDSR 100.00 7e-05
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号