SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16383  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA013737
Annotation
PREDICTED:_transmembrane_protease_serine_11A-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.302 PlasmaMembrane   Reliability : 1.093
 

Sequence

CDS
ATGGAGGTGGAAACAGTATTTGTTTACGATGGATACAATTATGAAAATGGAACAAATAACATTGCGTTGTTAGAACTGAAGAACGATGTGGTGTTTAACGAAAAAGTCCAACCTGCGTGTCTGTGGGAGTTCAGCGCATACAAGAAGTTAAATTTGAAAGACATCAAGGGATCTGTCATAAGCACAACTCTCGGCGAAGATATTGATGAAGGTCTCGAGGTAGAGAATATGAAAAAGCTTAAGCCTGTTAAAGAAGTAAATGTTTATAGGGAGGAAACATTTGAATCCAAATTCAACGCCACATCTATCAATCTGTGTACGAATGCTAAAGATTATGATAAGCATTGGGCTTTGATTGGGAATCCACTTCTTCATGCAGCTCCGTGCATCGGAAACAGTAAAGTATCTATATCATATGAACCGGGCCTGGCACCGGAGGAAGAAACTAAATACAATTTATTTATAAACGGCCCTTTTCCCGAACACACGACAATCAAAATGAAATTTGATTCGCCCGCCAATGTGACTCTGAGCAACGACGTAGGTAAATTAGCAAGAGTGTCTTCCTCTGCTGACGGAATGTTCTTCATCAAATACTTTAAAGGCGGACCCTATTTCAGTGCAGATGTGATAGGTTTAAACTTATCCGTAGTACCTTACCCGACCACTATTAACTTAAACTTTGTCGAATACTGCGAGCACCCGGCACTTGGAATCTTAGATGGATATATCAACGGATATAAATCAACAGCCTCATCTACTTATACAGAACACGATGACAACTGTGGAAGAATTAAAATCTCCGAAAAACAATGCGGTGGAAACGAAGAAGAACCTATGCCCTGGCATGCTCTTATCAGAGACGACAACTCTACAATATGCGCTGGAACGTTGATATTACAGAGATATGTTTTGACAGCCGCTCAATGCGTCACAAACTTAGGCGTTGCGAAGAACGCCACAACTCTGTCTGTGGTTCTTGGGAAATTTAATAACACAAGTGATGAATGCTTACAGGAAATGGAGGTGGAAACAGTATTTGTTTACGATGGATACAATTATGAAAATGGAACAAATAACATTGCGTTGTTAGAACTGAAGAACGATGTGGTGTTTAACGAAAAAGTCCAACCTGCGTGTCTGTGGGAATTCAGCGCATACAAGAAGTTAAATTTGAAAGACATCAAGGGATCTGTCATAAGCACAACTCTCGGCGATGATATTGATGAAGGTCTCGAGGTAGTGAATATGAAAAAGCTTAAGTCTTCTAAAGAAGTAAATGTTTATAGGGAGGAGAAATTTGGATCCAAATTCAACGCCACATCTATCAATCTGTGTACGAATGCTAAGGATTATAATAAGCATTGGGCTTTGATTGGGAATCCACTTCTTCATGCAGCCCCGTGCATCGGAAACAGTAAAGTATCTATATCATATGAACCGGGCCTGGCACCGGAGGAAGAAACTAAATACAATTTATTTATAAACGGCCCTTTCCCCGAACACACGACGATCAAAATGAAATTTGATTCGCCCGCCAATGTGACTCTGAGCAACGACATAGGCAAATTAGCAAGAGTGTCTTCTTATGCTGACGGAATGTTCTTCATCAAATACTTTAAAGGCGGACCCTATTTCAGTGCAAATGTGATAGGTTTAAACTTATCCGTAGTACCTTACCCGACCACTATTAACTTAAACTTCGTCGAATACTGCGAGCACCCGGCACTTGGAATCTTAGACGAATATATCGACGGATATAAATCAACAGCCTCATCTACTTATACAGAACACGATGACAACTGTGGAAGAATTAAAATCTCCGAAAAACAATGCGGTGGAAACGAAGAAGAACCTATGCCCTGGCATGCTCTTATCAGAGACGACAACTCTACAATATGCGCTGGAACGTTGATATTACAGAGATATGTTTTGACAGCCGCTCAATGCGTCACAAACTTAGGCGTTGCGAAGAACGCCACAACTCTGTCTGTGGTTCTTGGGAAATTTAACACAAGTGATGAATGCTTACAGGAAATGGAGGTGGAAACAGTATTTGTTTACGATGGATACAATTATGAAAATGGAACAAATAACATTGCGTTGTTAGAACTGAAGAACGATGTGGTGTTTAACGAAAAAGTCCAACCTGCGTGTCTGTGGGAGTTCAGCGCATACAAGAAGTTAAATATGAAAGACATCAAGGGATCTGTCATAAGCACAACTCTCGGCGAAGATATTGATGAAGGTCTCGAGGTAGTGAATATGAAAAAGCTTAAGCCTTTTAAAGAAGTAAATGTTTATAGGGAGGAAACATTTGGATCCAAATTCAACGCCACATCTATCAATCAATCCGAAGCCTGCAAGCTAGTTGGTAGCGGATTTATGGTGTTTGTTCCGGATTCCCGTGAATTGAATAGCACCGGAGCGTGGTACATCCACGGAATCGTCGCTACGAACGATTCGACGCTAAAATGCGATTCTAGCGATCCCACTGATTTCATCAACTTAGACTACTTCAGAGGCTGGGTCCTGAACAAAAAGAACAGATCTTAA
Protein
MEVETVFVYDGYNYENGTNNIALLELKNDVVFNEKVQPACLWEFSAYKKLNLKDIKGSVISTTLGEDIDEGLEVENMKKLKPVKEVNVYREETFESKFNATSINLCTNAKDYDKHWALIGNPLLHAAPCIGNSKVSISYEPGLAPEEETKYNLFINGPFPEHTTIKMKFDSPANVTLSNDVGKLARVSSSADGMFFIKYFKGGPYFSADVIGLNLSVVPYPTTINLNFVEYCEHPALGILDGYINGYKSTASSTYTEHDDNCGRIKISEKQCGGNEEEPMPWHALIRDDNSTICAGTLILQRYVLTAAQCVTNLGVAKNATTLSVVLGKFNNTSDECLQEMEVETVFVYDGYNYENGTNNIALLELKNDVVFNEKVQPACLWEFSAYKKLNLKDIKGSVISTTLGDDIDEGLEVVNMKKLKSSKEVNVYREEKFGSKFNATSINLCTNAKDYNKHWALIGNPLLHAAPCIGNSKVSISYEPGLAPEEETKYNLFINGPFPEHTTIKMKFDSPANVTLSNDIGKLARVSSYADGMFFIKYFKGGPYFSANVIGLNLSVVPYPTTINLNFVEYCEHPALGILDEYIDGYKSTASSTYTEHDDNCGRIKISEKQCGGNEEEPMPWHALIRDDNSTICAGTLILQRYVLTAAQCVTNLGVAKNATTLSVVLGKFNTSDECLQEMEVETVFVYDGYNYENGTNNIALLELKNDVVFNEKVQPACLWEFSAYKKLNMKDIKGSVISTTLGEDIDEGLEVVNMKKLKPFKEVNVYREETFGSKFNATSINQSEACKLVGSGFMVFVPDSRELNSTGAWYIHGIVATNDSTLKCDSSDPTDFINLDYFRGWVLNKKNRS

Summary

Similarity
Belongs to the peptidase S1 family.
Pfam
PF00089   Trypsin
Interpro
IPR033116   TRYPSIN_SER        + More
IPR001314   Peptidase_S1A       
IPR009003   Peptidase_S1_PA       
IPR018114   TRYPSIN_HIS       
IPR001254   Trypsin_dom       
SUPFAM
SSF50494   SSF50494       
PDB
2BQW     E-value=6.6546e-10,     Score=157

Ontologies

Topology

Length:
851
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0413000000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00071
outside
1  -  851
 
 

Population Genetic Test Statistics

Pi
359.027244
Theta
158.073873
Tajima's D
4.500998
CLR
0.248362
CSRT
0.99990000499975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 STASPTAPGGISQGNIAAIAK 100.00 2e-04
28467696 STASPTAPGGISQGNIAAIAK 100.00 2e-04
29197581 IVGSGFMVFVPDSR 100.00 2e-04
29197581 IVGSGFMVFVPDSR 100.00 2e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号