SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16369
Pre Gene Modal
BGIBMGA013747
Annotation
PREDICTED:_uncharacterized_protein_LOC105843021_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.06
 

Sequence

CDS
ATGGGTGCGTATCGCGAAAGTCTGATACGAAAATGGAGATTTATCAAAACCATCAGGCGGTCCACGAGGTCGCAATTTTATACAGATGAAGTGGAAGGAGATCCTAAGAGTGAGGACAAATGGCGTAAGGTGTGGAGCGATTATAAGAATAATTGCAAGAAAAAGTGTGCTAAAATTAATAGAGCTGCTAGTGGCACTGGTGGCGGACCAGCGCTCCATTTATTATTGACTGACCAGGAACAAAGGGTCATGCAGATAATTGGAGTGCAGGCAGCTACTGGCATGGAGATAAAAGAAGCTGGGTTTCCACAAGAAGAAATTTCAACTGAGAGGCCAAATACTCAAATTATTTTAAAGGAACCGGAAATAGATTGGAACACTCCTAGCACAAGCAGTCAACCAACAGTGGCTCCACCAACACCAACTGAGGCTCCCCCTCCAGTTATTAACGAGGAAGAGGAGTGGAACCCTCCGCCACAGAAAAAAAGAAAAAACAATTTAACAAAAATGTTTTTAGATATAGAAAAGCAAGAAAGAAAGAAAGAAGAAAGAAGAAAGAAAAGAAGAAAGAACAGAAAGGCAAGGGAGTATGCTTCAGAGCGTGATAGGGTATATGAGGAATTAGAAAGAGATCGGTTGAGAGTTAGAGAATTTGAGGTACGTGAAAGAGTAAGACAGAGAGATGAAGAGCTACGGATGCAGGGTCAATGGCTGGAATTTATGAAAGAGGCAATGGAAGCTTTTGTGAGGTTTATGGAGAGAAAGTCTTAA
Protein
MGAYRESLIRKWRFIKTIRRSTRSQFYTDEVEGDPKSEDKWRKVWSDYKNNCKKKCAKINRAASGTGGGPALHLLLTDQEQRVMQIIGVQAATGMEIKEAGFPQEEISTERPNTQIILKEPEIDWNTPSTSSQPTVAPPTPTEAPPPVINEEEEWNPPPQKKRKNNLTKMFLDIEKQERKKEERRKKRRKNRKAREYASERDRVYEELERDRLRVREFEVRERVRQRDEELRMQGQWLEFMKEAMEAFVRFMERKS

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
256
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03619
Exp number, first 60 AAs:
0.00433
Total prob of N-in:
0.08718
outside
1  -  256
 
 

Population Genetic Test Statistics

Pi
170.848478
Theta
170.779767
Tajima's D
-1.194327
CLR
0
CSRT
0.106394680265987
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号