SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16360
Pre Gene Modal
BGIBMGA013795
Annotation
PREDICTED:_Down_syndrome_cell_adhesion_molecule-like_protein_Dscam2_[Amyelois_transitella]
Location in the cell
Extracellular   Reliability : 1.515 Nuclear   Reliability : 1.457 PlasmaMembrane   Reliability : 1.205
 

Sequence

CDS
ATGCAAACTTTTACAGGTTTGGACAGAAGAAAAAGAATGTCAGCGAACCGGGTCATCATCACACAGCATTTCACGGAGCGAACCATCACACCCGGCGGTGATATCAGCATGCAGTGCGCAGCCACTGGCGATAAGCCTCCACAGTTTGTTTGGGAAAGAGACGGCATTGTGGTGTCAAGCAATACAGATCCTAGATATGCTTTAGGACAAGTCATGACATCAGACAATTCGGTGATCGCCCAACTAAATATAACAAGAGTCAGAGTCGAAGATGGAGGGCTTTACACGTGCACCGCTAAGGAAGGAGAATATAGTGCTAGTCACGAAAACAGACTGGATATTTATGGCCCACCATATATCAGATCCCTGCCACCAATCAAAGTGCAGAGCGGAGAATCGGTAAATTTAAGATGTCCATACTACGGATATCCAATAAGTAAAATCGATTGGGAACATCAAGGCCAAATCGTCAGCAGCAACGGCCTCTTCCAGAGCAGATACAAAAGGTCAATAACCCAACGCCGCAAAATCAGAAGAAACGCACCTACCGTCAACATTCACGGAGTGCTGACCATCTCGGAAGTCGACAAAGAACAAAGCGGTGCTGTATACACTTGCATCGTGACAAGTCCGTCAGGGGAAATGGCCAGAAGGGCTTTCGAGATCCAAGTAATCGAAGCGCCAGTCTTAGATGAACTGCTTTTGGGAAGCAACCTGCAGGAGGGGCAAATAGCAAACATTTACTGCAACGTCAGGACTGGAGATTTGCCGATACATTTCGAATGGTTGAAAGACGGGAAAAGAATACCTAGCAGTTTGAAGGTGGCAGAAAGAAACTCGGAGCTTTTCAGCGCCCTGGTAATCAAGAAAGTTTCTTTAGAGCATTGCGGTACTTACACTTGCGTCGCTTCGAACCACGTAGCAAAAGTTAATCGATCCACTGAGCTTTATATCAAAGTTGCTCCGAAATGGTTGGAAGAGCCATCAAATACATCATTACTTCTCGGCAGGAAGGGAGCAGTCTCGTGTAGTGCTAGCGGATATCCTCAACCACAAGTGCATTGGATGAAAAAGGACGCGCTGTTAGGAACGTGGCAACCAGTTCTGGAGCTAGCTGGCGGTGGAATACTCAGCCTTCCGAATGGTACGCTCGTTATTGAGGACGTGTCAGTCACGGACGAGGGTTTGTACTCGTGCAATGTTGAAAATGGCGTCGGCCAGCCTCTAAGCAAAACCATCTGGATGAGTGTGAACAAGCCGGTCCATTTCGACTCGTCTTCCTCAAACGTGACGTCACAACTCGGACATGCAGTGTCGCTGCAGTGCAGAGCTCTCGGCGACGACCCTATCCGCATCTCGTGGACTAAAGATGGGAAGATCATTAATCTTCAGAATCAGAGACTACAGCATTTGGACTCGAAGGCAAACCAAGGATTGGAAAGCACCATCAATATTCAATACTCAGAGACGACTGACGCAGGGCTTTACCAATGTCGAGCGAATAATCCATACGGTTCTGCGATTTTTAATATACACCTCACCATATTGGAGCCACCGAGTCCACCTGCCGAAGTTCGCGTAGAAGCAGTACGCCCTCGAGCCGCACTCTTGTCGTGGCGGGACTCTGCAAGGTCCTCGGTCGCGAACTACCTCGTCCAATATTGCGCTCTGAACTACGACCACGACTGGGATCGAGCAATCACCATTAATCACACTCGCAAAGACCTTGACATCCGACAGTCTCTAGAACTACAGAATCTTCGCCCGGCAACCTCATATGCAGTGAGGGTTGCTTCAACGAACCAAGTCGGCATCAGCCAATATACTGCGCCACTGCACTTCACCACCCACGAAGAAGCTCCGACGTCACCACCGGTAAACGTTCAAGTGGAACAAACCGAGAATCCCGGAGAACTGTATATCTCGTGGCTACCTCCTCTTAAAGAGACCCATAACGGTATTCTTCTCGGCTACCATCTGAAGGCGGTTGCGCAGATTAGTGGCGCTGAGGAAGCTGATTCGAGGACGTTGAAGGTCTCACAGCTTTCCGGCAAACAAGAAACCGTCGTCAGTGGACTCCTCAAAAATACTAGATATGCTGTATCGATATCAGCTTTCACTAGTGCGGGTTCCGGACCGTTCTCGTTACCAGTCTTCCGAGACACGAGAGAAGGAGCACCGGAGCAGGCTCCATCTTCGGTGGAGTGCACGGCTGTCTCTCCCACCTCGCTACGTATCGGCTGGCAGCCTCTGACGTCACCGGGACACGGCAGCTCTCTCGTGGGGTACACTTTGCTATATGCAACTGAAGAAGGACCGTGGAACAATGTAACTTCACTCCACACCGAGATCTATCTTCAATCGCTGCTGAAGTACACGAATTACACCATCAAAGTGGCCGGCTTTTCCAACTATGGTGCCGGTCCGTATTCGTACCCGATTGTATGTGCCACACTTGAGGATGTTCCGGGTCCTCCGCCTGACATCAAAGTGCTGGTGACATCAGCCACGTCACTCCTTATCAGCTGGAAAAGACCAGACCAGCCCAACGGTGAAATTCTCCACTTCACAGCATACATCAAACCAACAACAAGCAATGGTCCACCTCAGACGCACGTCGTTGAAAGCTCCAAGACCACAAAAGAGGTGCGAGAACTCAGGACAGGATCCTCATATGAGTGCTGGGTCACAGCTTCCACCCGCGCCGGGGAAGGACCTCCTAGTAGAAGAGTTTCACACACTCCAACACATCGAGTGGTAGCGGGTGTGTCGTCCCTAGGCGGGGTGGTGTCGGCTGGCGCTGGCAGCTCGGTGCTGCTGGGATGCGCGTGCGTGGGGACGCCGGCGCCGCGCACCGTGTGGTACCGACACCACCACATCATCACGCACCACCCCAGATACACCAGGAACCATGATGATAGTCTGCTCATTAACAACATAGATCAGTCTTTAAGTGGGAACTACACCTGCCTGGCCAAGAATCTCTATGGGTCTGATTCCGTTGAGTACAACGTAGTGGTGCTACCCTTGCCCGAAGCGCCAATTCTGAGGGCTACACCATACAAAGACTCAATTTTAGTAGAATGGGAACAACCTTACTACATCACCAACAGAAGTTCCATTCAAAAGATTAGTTACAGTCTCACGTGGAAGGAAGCAAACGGTCAGTGGCAAGAAGCGTGGCAGGCTAACAAGATGCCCGACTTATCCACAGTCCATAAGTACTCCTTAAAAGGGCTCAAGTGTGGTACAAAATATTCTCTAAGGATCACAGCTACAAACAAAGTTGGTACATCACAACCGGCGTATTTAGAAGTCAGCACGTTGGGAGGAGCACCTGTAGCCCCATCTACGAATGAATGGCTTTGGAGCAATAGCTCCCATATTGTGGTGCAAATGGCTGGGTGGGAGTCAGCCGGCTGTGAGCTTCGAACTTGGGAAGTTGATTACAAAGCTCTTGGAGCAAGAACTTGGATACGCACTAGAAGTAACACGGCTGTAACCGACAGTTGGAATATGCTGTACCAAGATCCAACATTTCGCTCCGGCTCTCTGGCCATCGCCGGCCTGGCTCCTGGTACTTGGTACCAGGTCAGAGTGACGGCCACCAACGAAGCCGGAAGCGTAACCTCGCTTTATAATTATGCAACAAAGAATGAGGACGGAAGTGAAATCGGCCCGCCCTCAGATCTTTTTGATCTGAACATGCTTGTGATAATCTGCAGCTCTATACTACTGACAGTGTGTCTTCTCGCTTGTCTCTACATTTTAATTAAAAGACGAAGAAGCGGCAACCTAACAGAATACAGGGATTCAATAACGAATGACAATAAATCTGACAACGGCAACCTGACGGCCAACACTTCCCACTCGAATCTGGCCAACGTGAAAGAGAATCCTGGGAATCCACAAAACAGGATATACAGTGCACCGATACATATGAGAAACAACAGTAAGCACGTGTTATTTTCAGAACTATACGAGATAAGTCCGTACGCGCAATTCGCTGTTGGCTTCCGGACATTTGGACATGTTGAAAATCAAGATCTACCAAGTCGGGTCAAGCACAGATACGACACGGAGACGAGTTTCCAAGTCTGTTCAGAATCCGAAGACAGTGACAGCATATCAAAGTCCACGTTAAAAAGCGTTCCAAGGAAAATATGCAGAACTCCGCATCGCAGATAA
Protein
MQTFTGLDRRKRMSANRVIITQHFTERTITPGGDISMQCAATGDKPPQFVWERDGIVVSSNTDPRYALGQVMTSDNSVIAQLNITRVRVEDGGLYTCTAKEGEYSASHENRLDIYGPPYIRSLPPIKVQSGESVNLRCPYYGYPISKIDWEHQGQIVSSNGLFQSRYKRSITQRRKIRRNAPTVNIHGVLTISEVDKEQSGAVYTCIVTSPSGEMARRAFEIQVIEAPVLDELLLGSNLQEGQIANIYCNVRTGDLPIHFEWLKDGKRIPSSLKVAERNSELFSALVIKKVSLEHCGTYTCVASNHVAKVNRSTELYIKVAPKWLEEPSNTSLLLGRKGAVSCSASGYPQPQVHWMKKDALLGTWQPVLELAGGGILSLPNGTLVIEDVSVTDEGLYSCNVENGVGQPLSKTIWMSVNKPVHFDSSSSNVTSQLGHAVSLQCRALGDDPIRISWTKDGKIINLQNQRLQHLDSKANQGLESTINIQYSETTDAGLYQCRANNPYGSAIFNIHLTILEPPSPPAEVRVEAVRPRAALLSWRDSARSSVANYLVQYCALNYDHDWDRAITINHTRKDLDIRQSLELQNLRPATSYAVRVASTNQVGISQYTAPLHFTTHEEAPTSPPVNVQVEQTENPGELYISWLPPLKETHNGILLGYHLKAVAQISGAEEADSRTLKVSQLSGKQETVVSGLLKNTRYAVSISAFTSAGSGPFSLPVFRDTREGAPEQAPSSVECTAVSPTSLRIGWQPLTSPGHGSSLVGYTLLYATEEGPWNNVTSLHTEIYLQSLLKYTNYTIKVAGFSNYGAGPYSYPIVCATLEDVPGPPPDIKVLVTSATSLLISWKRPDQPNGEILHFTAYIKPTTSNGPPQTHVVESSKTTKEVRELRTGSSYECWVTASTRAGEGPPSRRVSHTPTHRVVAGVSSLGGVVSAGAGSSVLLGCACVGTPAPRTVWYRHHHIITHHPRYTRNHDDSLLINNIDQSLSGNYTCLAKNLYGSDSVEYNVVVLPLPEAPILRATPYKDSILVEWEQPYYITNRSSIQKISYSLTWKEANGQWQEAWQANKMPDLSTVHKYSLKGLKCGTKYSLRITATNKVGTSQPAYLEVSTLGGAPVAPSTNEWLWSNSSHIVVQMAGWESAGCELRTWEVDYKALGARTWIRTRSNTAVTDSWNMLYQDPTFRSGSLAIAGLAPGTWYQVRVTATNEAGSVTSLYNYATKNEDGSEIGPPSDLFDLNMLVIICSSILLTVCLLACLYILIKRRRSGNLTEYRDSITNDNKSDNGNLTANTSHSNLANVKENPGNPQNRIYSAPIHMRNNSKHVLFSELYEISPYAQFAVGFRTFGHVENQDLPSRVKHRYDTETSFQVCSESEDSDSISKSTLKSVPRKICRTPHRR

Summary

EMBL
BABH01025528    NWSH01000925    PCG73523.1    AGBW02010096    OWR49171.1    KQ459547    + More
KPJ00028.1    RSAL01000157    RVE45570.1    KQ459602    KPI93210.1    KQ460353    KPJ15639.1    AGBW02011290    OWR46880.1    KPJ00029.1    KQ461071    KPJ09867.1    AGBW02010870    OWR47596.1    KQ971307    KYB29801.1    KYB29803.1    KYB29804.1    KQ435922    KOX68634.1    NEVH01022635    PNF18616.1    PNF18614.1    PNF18619.1    JRES01001161    KNC24949.1    CCAG010010693    CCAG010010694    CCAG010010695    CCAG010010696    CCAG010010697    CVRI01000006    CRK88017.1    KQ978255    KYM95887.1    KQ978579    KYN30034.1    KQ976453    KYM85408.1    QOIP01000005    RLU23107.1    GL887813    EGI69926.1    ADTU01017524    ADTU01017525    ADTU01017526    ADTU01017527    ADTU01017528    ADTU01017529    ADTU01017530    ADTU01017531    ADTU01017532    ADTU01017533    KQ981920    KYN32984.1    ODYU01001341    SOQ37392.1    KZ149956    PZC76468.1    CH933806    KRG01529.1    KRG01530.1    EDW15371.2    CH902617    KPU80416.1    EDV43677.1    BABH01027510    BABH01027511    BABH01027512    BABH01027513    GAMC01005845    JAC00711.1    CM000160    KRK02724.1    KRK02722.1    KRK02723.1    EDW95788.2    KRK02725.1    CH480827    EDW44727.1    NNAY01000640    OXU27246.1    CH964232    EDW80662.2    AE014297    AAF55426.3    AAS65164.2    CH940650    KRF83565.1    EDW67931.1    CP012526    ALC46292.1    KRF83564.1    ABW08696.1    UFQS01000550    UFQT01000550    SSX04800.1    SSX25163.1    SSX04801.1    SSX25164.1    CM000070    EAL27462.3    KRT00047.1    CH479179    EDW24064.1    KRT00044.1    KRT00045.1    KRT00046.1    KRT00048.1    KRT00049.1    KRT00043.1    OUUW01000005    SPP80648.1    RSAL01000273    RVE43150.1    GEHC01000744    JAV46901.1    KQ414632    KOC67128.1    AXCN02001019    AXCN02001020    AGBW02008880    OWR52305.1    ATLV01022806    ATLV01022807    ATLV01022808    ATLV01022809    ATLV01022810    ATLV01022811    KE525337    KFB47992.1    GL767674    EFZ13261.1    JXJN01021159    JXJN01021160    ODYU01002306    SOQ39628.1    ADMH02000362    ETN66827.1    PZC76469.1    APGK01020326    APGK01020327    APGK01020328    KB740193    ENN81073.1    KB631669    ERL85186.1    GL436519    EFN71841.1    NEVH01020333    PNF21807.1    CM000159    KRK01032.1    KRK01031.1   
Pfam
PF07679   I-set        + More
PF00041   fn3
PF00047   ig
PF13895   Ig_2
PF02854   MIF4G
PF10523   BEN
Interpro
IPR036116   FN3_sf        + More
IPR013098   Ig_I-set       
IPR013151   Immunoglobulin       
IPR013783   Ig-like_fold       
IPR003961   FN3_dom       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR036179   Ig-like_dom_sf       
IPR003598   Ig_sub2       
IPR013106   Ig_V-set       
IPR027413   GROEL-like_equatorial_sf       
IPR003890   MIF4G-like_typ-3       
IPR016021   MIF4-like_sf       
IPR016024   ARM-type_fold       
IPR018379   BEN_domain       
IPR013087   Znf_C2H2_type       
IPR003006   Ig/MHC_CS       
SUPFAM
SSF48726   SSF48726        + More
SSF49265   SSF49265       
SSF48592   SSF48592       
SSF48371   SSF48371       
Gene 3D
PDB
3DMK     E-value=9.90754e-61,     Score=597

Ontologies

Topology

Length:
1395
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
23.04249
Exp number, first 60 AAs:
0.00056
Total prob of N-in:
0.00007
outside
1  -  1235
TMhelix
1236  -  1258
inside
1259  -  1395
 
 

Population Genetic Test Statistics

Pi
268.781654
Theta
171.306194
Tajima's D
1.921106
CLR
0.110799
CSRT
0.869906504674766
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号