SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16359
Pre Gene Modal
BGIBMGA013794
Annotation
PREDICTED:_Down_syndrome_cell_adhesion_molecule-like_protein_Dscam2_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.516 Nuclear   Reliability : 1.607
 

Sequence

CDS
ATGACCCAACATTTCAGTGGACAGATCGTTACGCCCGGTGATGACGTAAGCCTTCAGTGTACAGCTACAGCAGAAAGACCACCTAGATTCATTTGGGAAAGGGACGGTGTGACGATCACATCAAATACTGATCAAAGGTACACCCTTGGCCAAATGATGTCTGGAGTCGGAGTGGTGTCACAAGTGAACATCACGCGCTCAAGAGTCGAAGACGGCGGGGTCTACTCTTGCACTGCTTTAGAAGGAGACACGAAGATAACGCATTCAGCTCGTATAGATGTTTACGGACCGCCGTATATTCGGTCTCTACCACCGATAAAAGTACAGAGCGGAGAATCTTTGAAGTTAAGATGTCCCTACTATGGATATCCTATCAGCAAACTTGAATGGGAGCATAAAGGCGTGAAACTGAGTTCGACTGCTTTACCACAGCACGTTCGTTACAAACGTACCTTTACCACCGGCAAGAGAAGAAGAAGAAAACGACAGCTATACGAAAGAGATGAAAACGGAGTACTGAATTTACCTAAAGTCGTTAAAGAGGAGAGCGGGGATACATACACTTGTGTCGTGTATAGTCCTTCGGGAGAAATGGCTAGACGATCTTTCGAGATTCAAGTTGTAGAAGCACCTGAATTGGACGAACTAAGGGTCGGATCTGGACTGAAAGAAGGTCAAATAGTACAGATAACATGCAACATTGTCAGTGGAGATCCACCGATCTACTTCTCCTGGCTGAAGGATGGGAAGAAGATACCTCCTAGTTTGAAAATCACAGAAAGGAGTTCTGAGCTATTTAGCGTGCTGATTATAAAACGGGTAGCTTTGGAACACTGTGGAAAGTATACGTGCATCGCCACCAATCACGTGGGGAAGGTGAACCAAACCACGGACCTGTACATCAGTGTGGCCCCAAAGTGGGTGGACGAGCCAACGAATACATCCTTGCTATTAGGCCAAAGAGGCATGGTCTATTGCAATGCGAATGGATATCCAACCCCGCAAATACATTGGATGAAAAGAGACGCGACCCTTGGTATTTGGAGGCCAGTTTTGGATTTAGCCGGGGGTGGAGTGATCAGCTATCCCAACGGTACTCTAATCATAGAGGTTGTATCTCTGTCAGATGAAGGCCTGTACGCTTGTAATGTGGAGAACGGCGTAGGAGAAGCATTGAATAAGAAATTGTGGATTAGCGTTAACAAACCAGTCCACTTTGAATCAATAGGAGCTAATTTGACGACAAAGGCAGGACTTCCGGTGACCATTTCTTGTCGTCCACTCGGAGACAGTCCTATTAGAGTCAAATGGAGTTTGGACGGCAAACCTTTGGATTTTCCATCGTCAAGAATAACAATCTCAGAGACGAATACGCATAATGGGCTGAGCAGTGTCCTAAACATCAATTACGTGGAGAGTCGTGATCGGGGCTACTACGAATGCCGAGCTAGTAATCCTTATGGCGTCGCTGCTTATAATGTGAGGCTTAATATTCTAGAGCCACCGTCGTCTCCGGTGGAATTGCAATTAGATCACGTGTCTGGTAGCACAGCCAAATTGTCTTGGAGGGACACGATCATTGCGCACGTGGAGTACTACACTGTCCAGTTTACTAACAACGACTTCATGATGTGGGATTCAGCTAAGACCGTCAATGTTACCAGAGAAGATGGCCTCATTCGCCAGACTGTAGAGCTTACTGAACTTCAACCGTTTACGGAGTACCGGGTGAGGGTTGCAGCTGGAAACCAAGTAGATTTGAGTTCTTACACGCAACCCATTCATTTCACCACGCAGCAAGAAGCGCCCTCATCAGCTCCCATGGGAGTACAAGTGCAACAGTCTGATTCTCCTGGAGAACTGATGATTCGTTGGCAGTCACCGCCCCGGGACACACATAATGGACCTTTACAGGGATATCACGTAAAGGCCGTGCCATTTATTAGCGGAGATTCAGTTCCGAATGAGGCTCAAACGAAAATAATAAAAGTAATCGCAAGAAACGGAAAACAGGAAACAGTTCTGGGTGATCTACTCAAAAATGTGAGGTACGGAGTTTCAGTGAGTGCTTTTAATTCAGCAGGGAACGGACCATTCTCTGTGCCAGTCTATCAAACGACTAGAGAAGGAGCGCCAGAACAAGCTCCATCTGGTGTGGAATGCAGAGGAGTTTCATCCACGTCATTGAGAGTCAGCTGGCAACAGATAAATTCACGTGGAAGTTCTTTACTCGGCTATTTCGTGTACTACAGTACTGAAGACAGTTTGTGGTCGAACACAAGCACACCGCACACGGAGTTGTATATCCAGGGATTGTTGAAATACACGAATTACTCAGTGAAAGTAGCAGGATTCTCTAATTACGGACTGGGACCATTCTCTTATCCAATCATTTGTATTACGCTACAGGATGTTCCCGGGCCTCCTCCATTGATTAAAGTACTGGTATCGTCATCCACATCCTTGCTCGTCAGCTGGAAGAGGCCAGAGCAACCGAATGGCGAGATCACGCATTACACTGTTCACGTTAAGCCAGTTTCTAGTACCAACGCTCCACAGAGTTATAGGGTGGATGCGACACACGAATCCGCACTGACACGAGAGTCATCCTATTCTATAACTGGACTGATCACTGGGAGACAGTACGAGGTGTTCGTTCGTGCCCATACAACGGCAGGGGAAGGAACTCCGAGTAGGAGAGTCCATGCTGATTTATCTGCTAAAGTGGTAGCAGGAGTCTCATCACTGGGTGGCTGGGTAGCAGTAGGCGCGGGGAGCTCTGTGCTGTTGGCGTGCGCTTGTGTGGGCGTACCGGCGCCACGTACTGTGTGGTACAGACACCACCACATCATAACCCATCATCCTAGATACACGAGAAACCACGATGACAGCTTACTCATTAACAATATCGACCAAACTCTAAGTGGCAACTACACATGCCTAGCGAAAAATCTATACGGCTCTGATTCCGTTTCGTATGAAGTGACAGTACTACCGACGCCAGAGCCTCCGACCTTAAGGATTACAGCGCATAAGGATTCTCTACAATTACAATGGGATCCTCCTAGAAAAATAGCGGGAAAAGCGCAGAAAATCAGTTACAACTTGACGTGGAAAGAAGCCGACGGTTCCTGGCAGGACGCTTGGTCCAGTCGTGGGACGACGCTGCAAGGGATACAAGAGTACACATTACAAGGACTAAAGTGCGGTACCAAGTACTCTCTGAGGATCACCGCTGCTAATAGCGTTGGGTCTTCACAGCCGGCCTACTTTGACGCCAGTACTTTGGGTGGTGTGCCTATTGCTCCATCAAGCACCGAATGGTTTTGGAGCAATGCTACCCACATATACATACAGCTCAGCGGATGGGACGACAACGGCTGCGAGATCACAAGATTCGAAGTCGATTACCGGGAGTACGGTTCGAAGAGTTGGAGACGAGTGGATACTGGAATTCCTCCTATAGAACAACAATGGAATTACATGTCCTCGATACTAAATCAGCCGAACTCATTCGTGATCGGAGATTTGAATGCCGCCCAGTGGTACCAGATTCGGGTTTCCGTCGAGAACTCAGCGGGAGTTGCCACTTCGATTTATAACTATGCGACTTCTACGTTGTTCGGTGAGACAATCGGCCCTCCTTCAGAATACTTTGACATTAACATGCTAGTAATCATATGCAGTTCTATCCTGCTGATTATATGCTCAATAACGTGCGTTTATATTCTGGTAAAGAGACATAATCACAACAATATGACAGAATATCGGAATTCCCTAACGGTTGAATCTAAGTCGGAGCGTAGTGATGTACCCGCGAATACTCCTCAGAGCGTACCTTCGGATATCAACAACAGAGTGTACAGTACGCCGGTACATTTGACTGCCGATACCAAACACGAACTATACGAGATCAGTCCTTACGCACAGTTTGCGTTGGGCTTCAGAACCTTTGGCCACGTGGAAAATCAAGAAGTACCGAGCAGAATTCATTTGCCGAGTAACAGCAAGTCAAGATATGATACTGGTAGAAACCAGCTTCCAAATGAGATCGGAGTCAGAAGAGAGCGATTGCATCTCGAGGACGACAACTTTGAAGAGTGCTCCTAG
Protein
MTQHFSGQIVTPGDDVSLQCTATAERPPRFIWERDGVTITSNTDQRYTLGQMMSGVGVVSQVNITRSRVEDGGVYSCTALEGDTKITHSARIDVYGPPYIRSLPPIKVQSGESLKLRCPYYGYPISKLEWEHKGVKLSSTALPQHVRYKRTFTTGKRRRRKRQLYERDENGVLNLPKVVKEESGDTYTCVVYSPSGEMARRSFEIQVVEAPELDELRVGSGLKEGQIVQITCNIVSGDPPIYFSWLKDGKKIPPSLKITERSSELFSVLIIKRVALEHCGKYTCIATNHVGKVNQTTDLYISVAPKWVDEPTNTSLLLGQRGMVYCNANGYPTPQIHWMKRDATLGIWRPVLDLAGGGVISYPNGTLIIEVVSLSDEGLYACNVENGVGEALNKKLWISVNKPVHFESIGANLTTKAGLPVTISCRPLGDSPIRVKWSLDGKPLDFPSSRITISETNTHNGLSSVLNINYVESRDRGYYECRASNPYGVAAYNVRLNILEPPSSPVELQLDHVSGSTAKLSWRDTIIAHVEYYTVQFTNNDFMMWDSAKTVNVTREDGLIRQTVELTELQPFTEYRVRVAAGNQVDLSSYTQPIHFTTQQEAPSSAPMGVQVQQSDSPGELMIRWQSPPRDTHNGPLQGYHVKAVPFISGDSVPNEAQTKIIKVIARNGKQETVLGDLLKNVRYGVSVSAFNSAGNGPFSVPVYQTTREGAPEQAPSGVECRGVSSTSLRVSWQQINSRGSSLLGYFVYYSTEDSLWSNTSTPHTELYIQGLLKYTNYSVKVAGFSNYGLGPFSYPIICITLQDVPGPPPLIKVLVSSSTSLLVSWKRPEQPNGEITHYTVHVKPVSSTNAPQSYRVDATHESALTRESSYSITGLITGRQYEVFVRAHTTAGEGTPSRRVHADLSAKVVAGVSSLGGWVAVGAGSSVLLACACVGVPAPRTVWYRHHHIITHHPRYTRNHDDSLLINNIDQTLSGNYTCLAKNLYGSDSVSYEVTVLPTPEPPTLRITAHKDSLQLQWDPPRKIAGKAQKISYNLTWKEADGSWQDAWSSRGTTLQGIQEYTLQGLKCGTKYSLRITAANSVGSSQPAYFDASTLGGVPIAPSSTEWFWSNATHIYIQLSGWDDNGCEITRFEVDYREYGSKSWRRVDTGIPPIEQQWNYMSSILNQPNSFVIGDLNAAQWYQIRVSVENSAGVATSIYNYATSTLFGETIGPPSEYFDINMLVIICSSILLIICSITCVYILVKRHNHNNMTEYRNSLTVESKSERSDVPANTPQSVPSDINNRVYSTPVHLTADTKHELYEISPYAQFALGFRTFGHVENQEVPSRIHLPSNSKSRYDTGRNQLPNEIGVRRERLHLEDDNFEECS

Summary

EMBL
AGBW02011290    OWR46880.1    KQ459547    KPJ00029.1    NWSH01000925    PCG73523.1    + More
BABH01025528    AGBW02010096    OWR49171.1    RSAL01000157    RVE45570.1    KQ459602    KPI93210.1    KQ460353    KPJ15639.1    KPJ00028.1    AGBW02010870    OWR47596.1    KQ435922    KOX68634.1    KQ971307    KYB29804.1    KYB29803.1    KYB29801.1    KQ976453    KYM85408.1    KQ978579    KYN30034.1    KQ981920    KYN32984.1    ADTU01017524    ADTU01017525    ADTU01017526    ADTU01017527    ADTU01017528    ADTU01017529    ADTU01017530    ADTU01017531    ADTU01017532    ADTU01017533    NEVH01022635    PNF18614.1    CVRI01000006    CRK88017.1    PNF18619.1    PNF18616.1    KQ978255    KYM95887.1    GL887813    EGI69926.1    KZ149956    PZC76468.1    JRES01001161    KNC24949.1    RSAL01000273    RVE43150.1    UFQS01000550    UFQT01000550    SSX04800.1    SSX25163.1    SSX04801.1    SSX25164.1    CH933806    EDW15371.2    ODYU01001341    SOQ37392.1    QOIP01000005    RLU23107.1    KRG01529.1    KRG01530.1    CH964232    EDW80662.2    CP012526    ALC46292.1    CH940650    EDW67931.1    KRF83565.1    CH902617    KPU80416.1    EDV43677.1    KRF83564.1    AGBW02008880    OWR52305.1    CCAG010010693    CCAG010010694    CCAG010010695    CCAG010010696    CCAG010010697    NNAY01000640    OXU27246.1    CM000160    KRK02722.1    KRK02723.1    EDW95788.2    KRK02725.1    KRK02724.1    CH480827    EDW44727.1    AE014297    AAF55426.3    CM000070    KRT00044.1    KRT00043.1    AAS65164.2    CH479179    EDW24064.1    OUUW01000005    SPP80648.1    EAL27462.3    ABW08696.1    KRT00045.1    KRT00046.1    KRT00048.1    KRT00049.1    GAMC01005845    JAC00711.1    KRT00047.1    KQ414632    KOC67128.1    GEHC01000744    JAV46901.1    ODYU01002306    SOQ39628.1    PZC76469.1    AXCN02001019    AXCN02001020    ATLV01022806    ATLV01022807    ATLV01022808    ATLV01022809    ATLV01022810    ATLV01022811    KE525337    KFB47992.1    JXJN01021159    JXJN01021160    ADMH02000362    ETN66827.1    AJWK01012559    APGK01020326    APGK01020327    APGK01020328    KB740193    ENN81073.1    KB631669    ERL85186.1    GL436519    EFN71841.1    NEVH01020333    PNF21807.1    GGMS01016006    MBY85209.1    GDIQ01094716    JAL57010.1   
Pfam
PF07679   I-set        + More
PF00041   fn3
PF00047   ig
PF10523   BEN
PF02854   MIF4G
Interpro
IPR036179   Ig-like_dom_sf        + More
IPR003598   Ig_sub2       
IPR013783   Ig-like_fold       
IPR003961   FN3_dom       
IPR007110   Ig-like_dom       
IPR003599   Ig_sub       
IPR013098   Ig_I-set       
IPR036116   FN3_sf       
IPR013151   Immunoglobulin       
IPR013106   Ig_V-set       
IPR018379   BEN_domain       
IPR013087   Znf_C2H2_type       
IPR027413   GROEL-like_equatorial_sf       
IPR003890   MIF4G-like_typ-3       
IPR016021   MIF4-like_sf       
IPR016024   ARM-type_fold       
IPR003006   Ig/MHC_CS       
SUPFAM
SSF49265   SSF49265        + More
SSF48726   SSF48726       
SSF48592   SSF48592       
SSF48371   SSF48371       
Gene 3D
PDB
3DMK     E-value=4.70726e-53,     Score=531

Ontologies

Topology

Length:
1369
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
26.54115
Exp number, first 60 AAs:
0.00179
Total prob of N-in:
0.00027
outside
1  -  1222
TMhelix
1223  -  1245
inside
1246  -  1369
 
 

Population Genetic Test Statistics

Pi
266.470366
Theta
158.159017
Tajima's D
2.521221
CLR
0.33301
CSRT
0.944602769861507
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号