SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16351
Pre Gene Modal
BGIBMGA008832
Annotation
Retrovirus-related_Pol_polyprotein_from_transposon_TNT_1-94_[Papilio_machaon]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.782
 

Sequence

CDS
ATGTCGGTCGGCACGAGTTCGTCAATTCAACATGCCGCCATTGAAAAACTGCGTGGTGCAGAAAACTACTCCACGTGGAAGTTCTCCATGCGGATGTTATTAATCCATGAAGAGTTATGGGATTCCGTCATGGATAAATCGGAATTGACGGAAGCCATGAAGAAAAAGAGCGAAAAGGCATTGGCACGTATTGCATTGTCGGTGCAGCCAGCGGTCATCCCGTGCATCCGCACCGCCACCAGCGCACACGAGGCGTGGAATAACCTAAGTAAGGCATACGAAGGGCGCGGCTTGTGCAGGAGGCTTGGCATACTGAGAAGTCTCTTCGGTGTCAAGTTATCGGATAGCAGTTCCATGGAAGCCTACATCAATAAAATTAAAGAGTTGGCGTATCAACTGAGTGAAATGGAATCCGCATTGGATGATGAGTTTATTGCCGTTATAATGCTAAGTGGGCTCACAGAAGATTTTGACCCCCTCATTATAGCAATTGAGAACTCAAATGTAAAACTCACCACGGAACTTGTCTCAGGAAAACTCATAGCAGAAAACCAGAGGCGTAAGGAGAAACAAGAAGTCACTGCGTTGGTAATCAAGAAGCAACCGAGATGCTTCAAGTGCAAAAATGTGGGTCACATTTCTAAGAATTGTACCAACGAAGGAAGCTTCAAGGAGCCAGCGGACGTAGGAGGCAACAAGGGCCAAAATAAATCCAGGTATCAGGCGAGGAGCAATCCGAAGCAGAATATCCCAAAGGACAAAGCGCTCGTTGCAGCTCTGTCTGTAAAAATAAGCAGTGATGTGTGGTGCATTGACTCAGGTGCTACTAATCATATGTGCAATGATAAAAGGTACATGATTGACTTCCGACCTAATAGTGTGGATGTGAGCATCGCGAATGGTGAAATGCTACGAACAGGTGGCATTGGACATGTAAGAGTTCATATGAAAGACTGTATAAGGACAATAAGTGATGTGTATTATGTTCCTAATCTTAGTACTAACTTATTGTCAGTAAGTGCCATGACAAAGAAAGGGTATACTGTTCAATTTAATAATAAATTATGTAGGGTCTATGACAAACATGAATGTCTAGTAACAGGTACACAGATAAATGGTGTCTATCAGCTGGATACTGTGTCAGACAACGGCTGTGTCGTCGCTTCGACTGTGGTGGCATCGGCAAAGACTCACACTGCTAATGCGGCAACGATGTTATCTCAGGAGGTATGGCACAGAAGACTCGGACACCTAAACTTGAGGAGTATGCAATTGCTACAAAAAGGTATGGCTGGTGGCATTTCATATAGTTTGTCTGATTTTAAACAGTGTATTCCTTGTATAGAAAGTAAACAAAGTAGACTCCCTTTTCCCAAAAAGTCACACACTAGAGCTAAGGAAAAATTAGGTCTTGTACATAGTGACCTTTGTGGTCCCCTTCAGGTCCCTTCATTCAGTGGTGCCAGGTATTTTCTAAGTTTCATTGATGACTTCTCCAGGAAGCAATATGTTTATTTTTTAAAATATAAAAATGAAACTTTTGGGTATTTCCAACAATTCAAAGCTCTGGCTGAGAAAGAAACGGGAAAGAAATTAAAAATACTTAGGACTGATAGGGGCGGTGAGTATATGAGTCATGAGTTTCAGGAATTTCTCAAGAAGAATGGCATCCAACACCAGAAAACTATTGCGGATAGTCCGCAACAGAATGGTGTTGCTGAACGGGCCAATAGGACCGTCATAGAGAAGGCACGGAGTATGCTGCGGGATGCTAGCCTGGGAATGAAATTTTGGGCTGAGGCTGTGAACACTGCCGTATACCTTAAGAACCGGAGTCCAACAAAAGCTGTCATAGGAGCTACTCCGGAGGAAAAATGGTCAAACAAAAAGGTAAATCTGCATCATTTAAGAATTTTTGGATGCATTGCATATGCAATGATAAGGAAAAGAAAGAAATTAGAATCAAAAAGTAAACCATATATATTTGTAGGCTACAGTGAGGAGTCAAAAGGCTATAGACTCATAGACCCACATGATCCCACTAATTGTGTCTTTGCTCGTGACATAGTTTTTGTTGAAACAAAATTCTACGACAAAGAAAGTGTGTCACATGATGAAAATTCAGACCAACACATGTTTGTTAACATGAGTTTAAATACAGTTGGTCCGAATGAGCTACCCACTGTGAGTTCTGATGTTTCTGATGACACAATATTATCACAGAGCGGACACAGAAAACAGAGGCATAGCGCAATCACATTGGACGATTCTGATAGCGGAGAAACGGATTATGATACAAATGACTGCTTGGATGAAACTTATATTCCAGGGGACGATTCATTGGTTGAAGCAGAGGAGACAGATGATTCATATGAAGATTTGCCAGATTCTCCGCTGAGGGCAAGCTTCGTGAGATTAGTCGACAACCCTGATGATCCCCAGACTGCAGCCGAGGCCTTAAACGGGCCTGAATCGGACAGTTGGAGAAAGGCAATGACAGATGAGTATAATTCCTTTGTTAAGAACAAGTGTTGGACCCTGACTGAGCATGAACCCAGCCGCAAACCAGTCAAATGTAAATGGATTTTTAAAAGAAAATATGGAGCAGATGGAGAGTTACTAAAGTATAAAGCTCGTTTAGTTGCCAAGGGTTACACACAGAAGTACGGTGTTGATTATCAAGAGACTTTTTCACCAGTGGTAAGGTACTCCACAATTAGGATTTTACTTGCTTTAGCAGCTGAACATGGCCTGTCCATTGAGCACCTGGATGTCAAAACGGCGTTCCTTAATGGCGACCTCGAGGAAACTGTATACATGGAGCAGCCAGAGTTCTTTGAAGAAAAAGGAAAAGAGAACATGGTGTACAGGCTAAATAAAGCTGTGTACGGCTTAAAACAGGCATCCAAGACATGCTGA
Protein
MSVGTSSSIQHAAIEKLRGAENYSTWKFSMRMLLIHEELWDSVMDKSELTEAMKKKSEKALARIALSVQPAVIPCIRTATSAHEAWNNLSKAYEGRGLCRRLGILRSLFGVKLSDSSSMEAYINKIKELAYQLSEMESALDDEFIAVIMLSGLTEDFDPLIIAIENSNVKLTTELVSGKLIAENQRRKEKQEVTALVIKKQPRCFKCKNVGHISKNCTNEGSFKEPADVGGNKGQNKSRYQARSNPKQNIPKDKALVAALSVKISSDVWCIDSGATNHMCNDKRYMIDFRPNSVDVSIANGEMLRTGGIGHVRVHMKDCIRTISDVYYVPNLSTNLLSVSAMTKKGYTVQFNNKLCRVYDKHECLVTGTQINGVYQLDTVSDNGCVVASTVVASAKTHTANAATMLSQEVWHRRLGHLNLRSMQLLQKGMAGGISYSLSDFKQCIPCIESKQSRLPFPKKSHTRAKEKLGLVHSDLCGPLQVPSFSGARYFLSFIDDFSRKQYVYFLKYKNETFGYFQQFKALAEKETGKKLKILRTDRGGEYMSHEFQEFLKKNGIQHQKTIADSPQQNGVAERANRTVIEKARSMLRDASLGMKFWAEAVNTAVYLKNRSPTKAVIGATPEEKWSNKKVNLHHLRIFGCIAYAMIRKRKKLESKSKPYIFVGYSEESKGYRLIDPHDPTNCVFARDIVFVETKFYDKESVSHDENSDQHMFVNMSLNTVGPNELPTVSSDVSDDTILSQSGHRKQRHSAITLDDSDSGETDYDTNDCLDETYIPGDDSLVEAEETDDSYEDLPDSPLRASFVRLVDNPDDPQTAAEALNGPESDSWRKAMTDEYNSFVKNKCWTLTEHEPSRKPVKCKWIFKRKYGADGELLKYKARLVAKGYTQKYGVDYQETFSPVVRYSTIRILLALAAEHGLSIEHLDVKTAFLNGDLEETVYMEQPEFFEEKGKENMVYRLNKAVYGLKQASKTC

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Similarity
Belongs to the protein kinase superfamily. Ser/Thr protein kinase family.
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
KQ460882    KPJ11482.1    JYDJ01000136    KRX42725.1    JYDJ01000808    KRX33413.1    + More
JYDH01000330    KRY26802.1    JYDT01000069    KRY86576.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    JYDR01000001    KRY80095.1    LBMM01004924    KMQ91985.1    NEVH01006721    PNF37230.1    NEVH01002725    PNF41351.1    NEVH01019375    PNF22597.1    NEVH01006980    PNF36330.1    GBHO01036544    JAG07060.1    NWSH01000816    PCG74073.1    KQ460208    KPJ16606.1    KL367628    KFD61291.1    NWSH01002292    PCG68657.1    PCG68658.1    KQ460297    KPJ16236.1    KL367553    KFD64618.1    GDHF01030254    JAI22060.1    JYDQ01000379    KRY07987.1    GAKP01015352    JAC43600.1    GBHO01011746    GBHO01011744    GBHO01011742    JAG31858.1    JAG31860.1    JAG31862.1    FJ238509    ACI62137.1    GBXI01002679    JAD11613.1    GBXI01011094    JAD03198.1    GEZM01011856    JAV93393.1    GEDC01002834    JAS34464.1    CM007900    OTG08534.1    CM007901    OTG04806.1    GAMC01008929    JAB97626.1    CM007899    OTG12557.1    LBMM01012669    KMQ86061.1    GEZM01045163    GEZM01045162    JAV77888.1    GDHF01029191    JAI23123.1    JYDU01000001    KRY01876.1    KQ459875    KPJ19636.1    GEZM01011857    JAV93390.1    GBHO01033237    JAG10367.1    LBMM01011374    KMQ86881.1    NEVH01021933    PNF19227.1    CM007895    OTG22666.1    GDHF01027648    JAI24666.1    GAMC01019995    JAB86560.1    JXUM01099923    KQ564528    KXJ72133.1    GBHO01033235    JAG10369.1    GDHF01006360    JAI45954.1    GBHO01003630    JAG39974.1    GAMC01019998    JAB86557.1    OIVN01006429    SPD32977.1    GDHC01012180    JAQ06449.1    X13777    LXQA010000742    MCH80155.1    KQ484038    KYP38095.1    LBMM01012645    KMQ86082.1    AC149291    AAT38758.1    LBMM01008124    KMQ89126.1    KQ483889    KYP39674.1    KZ669858    PPR84446.1    GEHC01000879    JAV46766.1    KRY26801.1    KZ662693    PPS20553.1    OTG06758.1    GFTR01008662    JAW07764.1    GDUN01000695    JAN95224.1    GEFH01000951    JAP67630.1    LBMM01015747    KMQ84682.1    JYDK01000071    KRX78146.1    LVZM01021469    OUC41357.1    GAMC01011082    JAB95473.1    GFWV01017285    MAA42013.1    KA648745    AFP63374.1    CM007903    OTF97594.1    DF973341    GAU26746.1    ASHM01014140    PNX96091.1    DF973299    GAU24969.1    OTF99426.1    PDCK01000045    PRQ17740.1    GAKP01008575    JAC50377.1    DF974949    GAU51028.1    GBHO01024949    JAG18655.1    GBHO01024951    JAG18653.1    GBHO01024947    JAG18657.1    GBHO01024950    JAG18654.1    GDUN01000696    JAN95223.1    LXQA010000257    MCH79654.1    LXQA010000987    MCH80374.1    CM003611    KYP60712.1    CM003372    KOM33859.1    AP002064    BAB01972.1    GBXI01017107    JAC97184.1    CM003608    KYP66486.1    JAV77889.1    JYDM01000185    KRZ84108.1    GDHF01029405    JAI22909.1    AF279585    AAK29467.1   
Pfam
PF13976   gag_pre-integrs        + More
PF00665   rve
PF13961   DUF4219
PF07727   RVT_2
PF00098   zf-CCHC
PF00069   Pkinase
PF08263   LRRNT_2
PF01582   TIR
PF00931   NB-ARC
PF00248   Aldo_ket_red
PF08370   PDR_assoc
PF00005   ABC_tran
PF01061   ABC2_membrane
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR025314   DUF4219       
IPR025724   GAG-pre-integrase_dom       
IPR036397   RNaseH_sf       
IPR009056   Cyt_c-like_dom       
IPR011009   Kinase-like_dom_sf       
IPR000719   Prot_kinase_dom       
IPR013210   LRR_N_plant-typ       
IPR017441   Protein_kinase_ATP_BS       
IPR032675   LRR_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR000157   TIR_dom       
IPR036390   WH_DNA-bd_sf       
IPR002182   NB-ARC       
IPR035897   Toll_tir_struct_dom_sf       
IPR027417   P-loop_NTPase       
IPR036812   NADP_OxRdtase_dom_sf       
IPR023210   NADP_OxRdtase_dom       
IPR003439   ABC_transporter-like       
IPR013525   ABC_2_trans       
IPR013581   PDR_assoc       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF56112   SSF56112       
SSF46785   SSF46785       
SSF52200   SSF52200       
SSF52540   SSF52540       
SSF51430   SSF51430       

Ontologies

Topology

Length:
972
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01491
Exp number, first 60 AAs:
0.0003
Total prob of N-in:
0.00064
outside
1  -  972
 
 

Population Genetic Test Statistics

Pi
336.328048
Theta
153.240037
Tajima's D
1.137559
CLR
0.24307
CSRT
0.696865156742163
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号