SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16350
Annotation
PREDICTED:_zinc_finger_BED_domain-containing_protein_1-like_[Amyelois_transitella]
Transcription factor
Location in the cell
Nuclear   Reliability : 2.725
 

Sequence

CDS
ATGGGACCTAAGAAAAAAAGTTCCGTTTGGCAGTTCTTTAACAAAATTGACGATAAGAAAACGAAATGCAAACTATGTCAAAAGGAAATTAAGTCTGCTGGAAACACTACGAACTTAATTGGACATATTCGTAATGTTCATAAGGCTGCTTATCTCGAAATTCAGCCGAAACAAACTACATTCAATGCAGTAACTACTACAGACGAAATATCGAATCCTCTGGATCTGGATACCAAAGTTACGCCTTATAATAAAATGGATGATGGAGTACTTCAGTTTCAACCTGTTCCAAGTTGTAGTGGCAGTCAAAGATCCGGTGCACCGTTACCAAAAACCGTAAATGAAACCATTGATTCAGACTTAGACGAAAACGTTACACCTTTAAAACGCCAAAGAACAATACAGGCCGCTTTTAAAGATATTTCCTCTTACTCAGAATCTGGAGCGAAGACAAGGAAACTGAACAACTGTTTGTTATTCATGATTTGCAAAGACCATCAGTCATTCTCAATCGTTGAAAACGAAGGCTTCAAAACTCTAATGAAAACAGTTGCTCCTCAATATAAGCTCCCGAGTAGAACAACTCTAAGACGCTGGCTGGACGATAAATATGAAGTAATTTCAGAAACAATTAAGAAAATGTTGTCCTCTATAGAAGATATAACCCTAACAACAGATATTTGGTCGGATACCTTGAATATGAAAAGTTTTTTGGGCATCACAGCACATTTCGGAATAGACATTGAACTATATTCAGTCACCTTAGGTGTGTACGAATTGGATGAAAGACATACATCAGATTATCTTTCTGAAATTCTCTTAAAGGTATGTCAAGACTGGAAAATCGATCAAGAGAATGTAACAGCTGTTGTTACTGACAACGCAGCCAATATAGTTAAGGCGATCGAATTAGCGTTTGGTAGAAGGAAACACATCCCATGTTTTGCCCATACTCTGAATTTGGTGGCTGAAGGCACAATGATATGTATTGAGTGGAGAAACATTGTTTCTAAAGTAAAATCAATAGTGACTTGGTTTAAACAGAGTTGCATTGCTAGTGATGAATTACGTAAAGCTACTGCTGCGGCTACGGAGTCTTCTGCTGGAGCAGCTGAGGTAAAATTAATACAAAGCGTCGATACTCGCTGGAACAGTACATATTATATGTTACAAAGATTTCTAGAACTCCGTAGTGTCATAAATGATATTCTCTTCCGCCACCCTAGAGCACCTGCAATGCTGAGTGCATCGGAAATATCTACTGTATCGTCTGTCATCATGGTATTGCGACCCTTAGAAGCGGCTACAAAAGAAATTTCAGGTGATAAATACTGCACAAGTAGTAAAATTATTCCCTTAGTTCGTTGCATGCTCTCTAAAATAACTTCAGCTGTTATAGAAGATCCCGTAGCGAAAGAGGTGCAGAAACTTGCTATTAATGAAATAAATAAAAGAATGGGTTCAATAGAACATGTGAATGCTCTGGCTATCGCAAGTATTTTAGATCCACGGTTTAAAAGAATGCATTTCAATGATCCGATAGCTTGTTCGAATGCTGTTACGAAAATTAAAGATTTAATGAAGAAGAATTTGCATAGCAATGAAGAACCTGAGTCCGATTCTGACAAGTCCGATAAAAATGAAGAGGCCTTTTCATTATGGACTGATCACCATAAGTTAGTGCATCGTAACTGGAAAATTAACAAATCTGAAGACGTTTTGTCTGACGAACTTTCCGTTTATCTCCGAACTCCTGTTGGAAGACTTAAAGAAAATCCGTTAGAAATTTGGAGAGATTACAAAATACAATTCCCGAAGCTGTACAAAATAGCTTTTAAGTATTTAACAATAGTTGGCACGTCAGTCCCTTCAGAAAGACTTTTGTCACAGGCAGGGCTAGTTATGACTGAACAAAGAAACCGGCTGAAGGGGAAGAGATTAAGCAAACTTTTGTTTTTACATAGCATTGACAAAAAATATTGGAATATGTAA
Protein
MGPKKKSSVWQFFNKIDDKKTKCKLCQKEIKSAGNTTNLIGHIRNVHKAAYLEIQPKQTTFNAVTTTDEISNPLDLDTKVTPYNKMDDGVLQFQPVPSCSGSQRSGAPLPKTVNETIDSDLDENVTPLKRQRTIQAAFKDISSYSESGAKTRKLNNCLLFMICKDHQSFSIVENEGFKTLMKTVAPQYKLPSRTTLRRWLDDKYEVISETIKKMLSSIEDITLTTDIWSDTLNMKSFLGITAHFGIDIELYSVTLGVYELDERHTSDYLSEILLKVCQDWKIDQENVTAVVTDNAANIVKAIELAFGRRKHIPCFAHTLNLVAEGTMICIEWRNIVSKVKSIVTWFKQSCIASDELRKATAAATESSAGAAEVKLIQSVDTRWNSTYYMLQRFLELRSVINDILFRHPRAPAMLSASEISTVSSVIMVLRPLEAATKEISGDKYCTSSKIIPLVRCMLSKITSAVIEDPVAKEVQKLAINEINKRMGSIEHVNALAIASILDPRFKRMHFNDPIACSNAVTKIKDLMKKNLHSNEEPESDSDKSDKNEEAFSLWTDHHKLVHRNWKINKSEDVLSDELSVYLRTPVGRLKENPLEIWRDYKIQFPKLYKIAFKYLTIVGTSVPSERLLSQAGLVMTEQRNRLKGKRLSKLLFLHSIDKKYWNM

Summary

EMBL
ABLF02010709    GDQN01002674    JAT88380.1    ABLF02008875    ABLF02006015    ABLF02030582    + More
KQ980290    KYN16919.1    KQ977395    KYN02984.1    GL441080    EFN65135.1    KQ977557    KYN02009.1    GL452203    EFN77752.1    ABLF02001734    KQ978037    KYM97822.1    KQ979507    KYN21183.1    KQ980204    KYN17277.1    ABLF02023260    ABLF02009488    LBMM01014067    KMQ85349.1    LKEX01009590    KYN50115.1    KQ980913    KYN11465.1    GGMS01006357    MBY75560.1    GGMS01015207    MBY84410.1    ABLF02017802    QOIP01000003    RLU24471.1    KK107161    EZA56605.1    KK107050    EZA61658.1    KQ977255    KYN04655.1    ABLF02011645    ABLF02044591    ABLF02050984    ABLF02055777    ABLF02018406    ABLF02026056    ABLF02057203    ABLF02030547    AF486809    AAL93203.1    ABLF02006624    ABLF02006626    GFTR01007466    JAW08960.1    CAEY01000832    GL436768    EFN71507.1    GGMS01006230    MBY75433.1    ABLF02011646    ABLF02021118    CAEY01000199    ABLF02014501    GGMR01013943    MBY26562.1    LBMM01003701    KMQ93224.1    CAEY01001590    NWSH01001073    PCG72760.1    PCG72759.1    LJIG01022898    KRT78170.1    NNAY01004948    OXU17200.1    ABLF02067360    HADY01017248    SBP55733.1    GBXI01000181    JAD14111.1    ABLF02013863    ABLF02021063    ABLF02051044    HACA01026053    CDW43414.1    ABLF02030460    ABLF02030462    ABLF02030463    ABLF02018503    ABLF02031891    HAEJ01007957    SBS48414.1    ABLF02012271    ABLF02011642    BABH01040014    HACG01045150    CEK92015.1    AAZX01004655    JTDY01001348    KOB74120.1    ABLF02055338   
Pfam
PF05699   Dimer_Tnp_hAT        + More
PF04937   DUF659
PF02892   zf-BED
PF13843   DDE_Tnp_1_7
Interpro
IPR037220   BED_dom        + More
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR007021   DUF659       
IPR036236   Znf_C2H2_sf       
IPR003656   Znf_BED       
IPR029526   PGBD       
IPR038261   GPP34-like_sf       
SUPFAM
SSF140996   SSF140996        + More
SSF53098   SSF53098       
SSF57667   SSF57667       
Gene 3D
PDB
6DX0     E-value=9.01366e-21,     Score=249

Ontologies

Topology

Length:
663
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0385
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00140
outside
1  -  663
 
 

Population Genetic Test Statistics

Pi
13.533824
Theta
21.866445
Tajima's D
-0.546399
CLR
168.980754
CSRT
0.228138593070346
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号