SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16342
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.192 Nuclear   Reliability : 1.408
 

Sequence

CDS
ATGGCGTTGGCGGAAGGGCCGGCGACTGCTGCGGCGTCGCCCGCCACCGGCTTCGAAAAAAGTTCCTCTTGCGGACTGGACGCTGCCTCCTCGGCGCAGTCCAGGGCCGCCTGCCGTGAGGCCCGGGAAAAATCAGAGATTGGAGTGGTTCAGCGCCTAGAGCGCTCCCTAACGGAGGTGGGTCCCTCTGACCCCCTCCGTGCATTCGAGGTGGTCGGAAAATTAGTTTCCGCAGTCGCCACAAAATCCGGCGGGGGACTCAAGGGTGATTATGTGCGGGCCCTAAAATCTGGAGCGGCCACTCTTGAAGAGAGATTGCAGGACGTAGTGAACCGCACCACAACCACGGAGACGGAAGGCTTGCGGCAAGAAGTAGCCCTGCAGCACGCCCGCCTTGAGCAACTGGCGGAGGAAAATGGCCGACTTCGGGCGGAGAACGGACAGTTCCGCGTCGACATGGCCGAGTTGAGGACCATGGTGGCCGACCTTATAGAGCGGCAACGCAGCTCGGCCCCTGTCCCTCCTCCGCCCGAAGCGGAAGGCCTCACTGAGGTCGAGCAGCTGAGGCGGCAGGTCCTCATCCAGGAAGCACGAAGCTCCAAGGTGGAGCGTGCGAGGCCGCCCCTCGCTCACGAGGCGAAGGGAAGTGCGCCTGTGCCAGCACCCCGCAGGACTATGCAACCCGCTGTTAGGACCTACAGCGCCTGCGAAGGCGGGGCCCGGCAGGAGCCGGACCAAGAAGAAGGGGGGCATCAACGCTGCGAAACCGGCCCCGACTCCCCAGCCCCGCCCGCTGCCCCGGCTCCTGCCACTATGGAAGAGGCATGGACAACGGTAGTGCGGCGTGGGCCCAAAAAGGTGGCGGCGCCTGTCGCGCCGCGCCCCAAGCCCGCCCCTGCGGCCGCCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCGAAATGGACGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTAGTGGAGCTGCTGCCGGCCGGCAAAGAAAAAGGCATCACCTACCACGAGGTGATGACCCAGGCGCGCGGCGGCGTGGATGTGGACGCCCTCGGCGTGGAGGGGGGCATCAAGGTCCGGCAGACGGCCAACGGGGCACGTCTCATAGAGTGCCCCGGCCCCAACACAAACGCCGCGGCCGAAAAATTGGCGGCCCGGCTGAGGGAGATCCTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTGAAGATGGGGGAAGTAAAAATCACGGGCCTCGACGAGTGCGCCACGAAAGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTTGGGGAGCTCCGGGCGACGTACTCCGGAACCCGGACGGCGTGGGCGCGTTGCCCGGTAGTAACGGCGAACCTCCTGGCCACCCCTCCACAGGGTCGGCCTTCGGACAGCCCTGGATGGCTGCGCGTGGGCTGGGTAGTGGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGTTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACCGTGGACCGCAGCGATCTGTGTTTCCGCTGCGGCCAACCGGGGCACAAGGCAGCCTCCTGCACCACAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCGTGTAAGTCCGCCCCCTCCTCTACCAAAACGAGGAGGGGCGGCAAGAAAAATAAAAAGAAGGAGAGGCCGGCTGCAATAAGGGCAGCCGGCGAGTCAGTTCCCGCCGCGGCACCAGACGAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCCGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATAGGGGACGTCGACGGCTCCGTGGCCATTGTGTTGAGACATTCCGCGGCGTTACCCCCCTTGGATATGGTGGCCAGGGGACCCGGAGGCACGGTCGCGACTTGCGTGCGGTGGAACGGGCAATCTCACGTGGACGTGACGTTCGCGTCCCCGTCCGCCGTGCGCCGCACCCGCGGCTGGCGCGTACTCGAGGGGGCGGAGACGCTCTCGGACCACAGATACGTCCGATTCGAGCTCTCCGCCTCCTCCTTGTCGTCGTCGTCAGCCGCGGGCGCCCGCGGTGAGGAGGAGCTCCCGCAAGGTGCGCCCCGTTCGTTCCCCAGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCCGAGCACCACGTGGGGGTGCGTTCTGGTGGTCGCCCGAGATCGCGAGACTCCGTGAGGAGTGCGTGAGGGCGCGCCGCCGGAGCGCACGCCACTGCCGCCGCCGTCGTCGCGACGCTACGTTCGCGGAGACGGCGGCCCGGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGTTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGCAGCGGGGGGAGACTTTGAGCCCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAGAATGAGAGCGAAGGACGCGGCCCCGGCCCTGACGGTGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTTGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCTGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACGATCGACGCGATTCTACGCGTGCGGGCCCTCTCCGACGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTGTCCTTAGATGTAAGGAACGCCTTTAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTACCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTCAGCGTAATTTGTTACGCTGACGACACGTTGGTCGTAGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACCAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGTTATTTCACGGGCCGGGACGAGCGCCGCCTCTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTACCTCGGCCTCGAACTGGACGGTCGATGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGGGCTCCCGTATGGTGCCACGCCCTGACCCGCAAGAACGTCGCGGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTTCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGTGTAGTTCGAGCGCGGAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGTACCGTCGAGGCGGTCCGTCCGGTCCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTGACGCAGATGTTGACCGGCCATGGGTGTTTTGGCCGGTACCTCTTTAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATTGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MALAEGPATAAASPATGFEKSSSCGLDAASSAQSRAACREAREKSEIGVVQRLERSLTEVGPSDPLRAFEVVGKLVSAVATKSGGGLKGDYVRALKSGAATLEERLQDVVNRTTTTETEGLRQEVALQHARLEQLAEENGRLRAENGQFRVDMAELRTMVADLIERQRSSAPVPPPPEAEGLTEVEQLRRQVLIQEARSSKVERARPPLAHEAKGSAPVPAPRRTMQPAVRTYSACEGGARQEPDQEEGGHQRCETGPDSPAPPAAPAPATMEEAWTTVVRRGPKKVAAPVAPRPKPAPAAAAPRQEGRAEPRGRNGRRRPRAPRSAAVVVELLPAGKEKGITYHEVMTQARGGVDVDALGVEGGIKVRQTANGARLIECPGPNTNAAAEKLAARLREILPDPEVVRIARPVKMGEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRATYSGTRTAWARCPVVTANLLATPPQGRPSDSPGWLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSDLCFRCGQPGHKAASCTTAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKNKKKERPAAIRAAGESVPAAAPDEPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWIGDVDGSVAIVLRHSAALPPLDMVARGPGGTVATCVRWNGQSHVDVTFASPSAVRRTRGWRVLEGAETLSDHRYVRFELSASSLSSSSAAGARGEEELPQGAPRSFPRWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPRAPRGGAFWWSPEIARLREECVRARRRSARHCRRRRRDATFAETAARLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPQRGETLSPPDGRHVGHASASPQRSRCRGAPSPYHGGGDPCGRVQNESEGRGPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALLFHGPGRAPPLGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRKNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLFKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000448664,     Score=109

Ontologies

Topology

Length:
1578
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18856
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1578
 
 

Population Genetic Test Statistics

Pi
1.312939
Theta
14.036956
Tajima's D
0
CLR
22.841622
CSRT
0.378131093445328
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号