SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16336
Annotation
reverse_transcriptase_[Lasius_niger]
Full name
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 3.541
 

Sequence

CDS
ATGGAAAGTCAGAGTAATGAGTGTGATTTGTCATGCGCCCCGGCTAACCCCCGGCGCCCTCTGGTACCCGGGCCGGAGGGTGTGAAATCTGCTACCGAAGACGGCATAGAAGTGGCAACCCAGGCTTCTATGCCAGTAAATGCTACTGGTCAAAAGAAGTTAGTTCAGCAGGCATTCCATCCTAGCCTCTTTTTAAATCGGCCAAGAAGTTCGTCCCTAGGAAGTCTTTCGAACCAGGCGTCTGCTAAAGAAAAATGTAGTCAAAGCTCTGAGGACTCTGCCGAAACGCTAAGAGATACCACATGCCCACCACCATGGCAAAGAGTTCCTGTAAGCAGAGGTGTCAAAAGAAAGAAAACATCTTACGGTCCAGTCCCAGAATCTGTGATAACCTCAAATAAATTTAGTGGTCTTCAAATTGATCTAACAGACGAAGACTCTGAAACTACTACGGTTAAAAAAACAAGTAAACCGCCCCCAATTATTCTATATGGGGTCGACGACATTAACAAACTTACTGAAATGCTAGAAACTGTCGCGGACGTGACAGAGTTCACATTCAAGATCACTAATCGAAACCAACTAAGGATGAACTGTGTTAACATGGATGTGTATAAAAGAATCCTTACCCTAGTGAGAGAAAAGGGGCTAATAGGCCACACTTTCAATCGAAAGGATGAAAGATGCCTCAGAATTGTCATACGGAACTTACACCCTTCTACACCCATTGACATTATCAAAGAAGAAATAGAAGCCACCGGAAATATTGTTAAGGGAGAAATAATTAATGCGAAATTCGGCCCCGAAAAGAAGCCTACTTCCACCTTTTTCGTGAATCTCTTGCCCGGCCCAAACAATAAAGCTGCTAAAGACCTTAAATTTATATACCATCAGTCTGTTGTTATCGAAGACCCGAGGAAAAGAAGGTCTATAATCCAGTGTCACAGATGCCAGCAATACGGGCACTCTAAGAATTACTGTATGCGACCTCCTCGTTGTGTTAAATGCGGCCAATCCCATAAGACCTCCGATTGCGATAAAAAAGACCGTAATACACCTGCGCTTTGTGCGCTCTGTAGTGGACCACATCCAGCCAACTATAAAGGATGCGAGCATAATTTAGATGTGCTGCTAATCTCCGAGGCTCACTGTACCGCGTCCTCTAGTATAAAATTCAAAAACTATGTGTGTTACGTCACTACTCACCCTGATGGTACTGGACATGCAGGAACAGCAATAATAGTACGAAAATCCATTAAACACCACCCAATGCCTGGCTACAAAACCGATCACATTCAAGCCACTACAATACTAATTGAAGACAAAAGTGGTTGTTTTAACTTGTCAGCAATATACTGTCCGCCAAAGCATAAAATCATGGGGGATATGTTCATAGATTTCTTCCAAAGTCTCGGAAATCGCTTTGTCGTGGGTGGAGACTGGAATGCAAAATGCACTTACTGGGGCTCGAGACTAACGACCACAAGAGGACGACAGTTGAAGCTCTGTGTGGATGATTGCAAATTAACCACAGTTTCAACTGGGGAACCGACTTACTGGCCCTCAGACCCAAATAAAATTCCAGACCTATTGGACTTCTTTATTTTGAAAGGGTTTTCAACACACTATATCAAATCTGAGTCGTGCTATGACAGCTCCACAGACCACACTCCAGTCCTGCTAAATTTGAGTACAATGGTGATAGAATATACGACACCTGAAAAATTGAGTAATAAAAGCACTGACTGGAAATCGTTCAGGGAAACCCTTGATGAAAAAATTGACCTGAAAGTAGCTCTGAAAACACCTGATGATATTGAAAATGCGACTAGATACATAACTAATCTGATCCAAGAAGCATGCTGGGTGTCCACGCCTGAAGAAGAGTCTGTAAAAACTCGTATAAACTATCCATTGGAAGTCAGAAAGGCAGTACTGGAAAAGAGGAGGCTTAGAAGAGTCTGGCACCAAAGCAGATTAGAAGCAGACAAGAAAGCGCTGTATAGGAGTGCGGTTCAACTAAAAGAAATACTGAACAACTGGCACAATAAAACGTTGGAGGATCGTCTCGTGACACTAACAGCCACTGCAGCAACTAATTACTCGTTGTGGAAATTCACCAAGAATTATAGCAGACCTCAGTCATTCAAACCTCCGATAAAAACCATGAATGGTTGGGCGCGAACATCTCAAGAAAAAGCAAACGCATTCGCTCAACATCTTGAATCAGTTTTTAAACCAAATGCTGACATAGATTTAGTACATGAGGAACATATCAATGAAATTCTGCTACAAGACTTCCAAATGCTACCCCCACAGCGGCCAGTCACAGTACGCGAAGTTTGGAGAGTTATATCAAAACTACAGGATAAAAAGGCTCCCGGATATGATCTTATAACCAAGGAGATATTAAAACAAATTCCAAGGAAGGTGGTAGTGTTCCTGACTTCACTCTATAATAGCATACTAAGAGTCCAGTATTTTCCAATGGCCTGGAAAGTATCTCACATAATTATGATTCACAAGATGGGCAAACCACCCAATGAAGTATCCTCATACCGACCTATAAGCTTGCTGCCAATACTTTCCAAAGTTTTCGAGAAGCTCCTGAAAGGTAGACTTGTCCCAATCCTCAATGACGAAAAAATCATTCCTGATCATCAATTTGGGTTTAGACGAAATCATGGCACGGTCGAACAAGTTCACAGAGTCTGTGAAAAAATACGCAAAAGTTTGGAAGAAAAACTCTACTGCTCCTCGGCGTTTCTAGATATACAGCAGGCCTTTGATAAAGTGTGGCATAAAGGCCTCCTGTATAAATTAAAGGCAGCGCTACCTCATCAGTATTATTGTCTGCTAAAATCGTATCTCGCAGACAGAATATTCCAGGTGAAAGAAGGGGATTCTTTGTCACGATTCTGCGATATCTCAGCAGGTGTACCACAGGGATCAGTCCTGGGACCACTATTATATACTATATACACTGCTGACCTACCTGAGGTTAATGATGTTACCACTGCAACATTCGCCGATGATACTGCAATATTGGTGAGTCACACGGATCGTTTTGTAGCATCACAAAGATTGCAAAAAGGTCTTGATAAAATATCCACATGGCTACACAAGTGGCGAATAAAAGCCAGTGCAAACAAGTCGGTACATGTTACATTCACATTGCGAAAAGGTGATTGTCCACCTGTCCATGTTAATAACGCTATATTGCCCCATCAAGACAATGTAAGATACCTGGGAATGCACTTGGACCGCCGCCTAACATGGAAACACCACATTCAAACTAAGAGACAGGAACTAAACATCCGATACAAAAATCTCCATTGGCTGTTGGGACGTAACAGCAAGCTGAGTGTTGACAACAAACTTTTAATTTACAAAGTTATCCTTAAGCCAGTTTGGCTGTACGGAATCGAATTATGGGGTAGCGCCTGCAATTCGAATATCAGTATTATACAAAGAATGCAAAACTGTATCTTGCGCTCCATAAGTGGTGTTCCGTGGTTGGTCACAAACACTGAAATACACAAAGAACTAGGGATGCCTACAATAATGCAGGAAATCGTAAAATTTAAACAAAAACACCACGAAAGACTGGAAAAGCACCCAAACAATCTGGCTGCCGCCTTGAAAAAACGAAGTTACGGTAAAAGGCTCAAGAGAAAAGACGTCATATAG
Protein
MESQSNECDLSCAPANPRRPLVPGPEGVKSATEDGIEVATQASMPVNATGQKKLVQQAFHPSLFLNRPRSSSLGSLSNQASAKEKCSQSSEDSAETLRDTTCPPPWQRVPVSRGVKRKKTSYGPVPESVITSNKFSGLQIDLTDEDSETTTVKKTSKPPPIILYGVDDINKLTEMLETVADVTEFTFKITNRNQLRMNCVNMDVYKRILTLVREKGLIGHTFNRKDERCLRIVIRNLHPSTPIDIIKEEIEATGNIVKGEIINAKFGPEKKPTSTFFVNLLPGPNNKAAKDLKFIYHQSVVIEDPRKRRSIIQCHRCQQYGHSKNYCMRPPRCVKCGQSHKTSDCDKKDRNTPALCALCSGPHPANYKGCEHNLDVLLISEAHCTASSSIKFKNYVCYVTTHPDGTGHAGTAIIVRKSIKHHPMPGYKTDHIQATTILIEDKSGCFNLSAIYCPPKHKIMGDMFIDFFQSLGNRFVVGGDWNAKCTYWGSRLTTTRGRQLKLCVDDCKLTTVSTGEPTYWPSDPNKIPDLLDFFILKGFSTHYIKSESCYDSSTDHTPVLLNLSTMVIEYTTPEKLSNKSTDWKSFRETLDEKIDLKVALKTPDDIENATRYITNLIQEACWVSTPEEESVKTRINYPLEVRKAVLEKRRLRRVWHQSRLEADKKALYRSAVQLKEILNNWHNKTLEDRLVTLTATAATNYSLWKFTKNYSRPQSFKPPIKTMNGWARTSQEKANAFAQHLESVFKPNADIDLVHEEHINEILLQDFQMLPPQRPVTVREVWRVISKLQDKKAPGYDLITKEILKQIPRKVVVFLTSLYNSILRVQYFPMAWKVSHIIMIHKMGKPPNEVSSYRPISLLPILSKVFEKLLKGRLVPILNDEKIIPDHQFGFRRNHGTVEQVHRVCEKIRKSLEEKLYCSSAFLDIQQAFDKVWHKGLLYKLKAALPHQYYCLLKSYLADRIFQVKEGDSLSRFCDISAGVPQGSVLGPLLYTIYTADLPEVNDVTTATFADDTAILVSHTDRFVASQRLQKGLDKISTWLHKWRIKASANKSVHVTFTLRKGDCPPVHVNNAILPHQDNVRYLGMHLDRRLTWKHHIQTKRQELNIRYKNLHWLLGRNSKLSVDNKLLIYKVILKPVWLYGIELWGSACNSNISIIQRMQNCILRSISGVPWLVTNTEIHKELGMPTIMQEIVKFKQKHHERLEKHPNNLAAALKKRSYGKRLKRKDVI

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
Pfam
PF00078   RVT_1        + More
PF07530   PRE_C2HC
PF14529   Exo_endo_phos_2
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5I1R     E-value=0.0488833,     Score=90

Ontologies

Topology

Length:
1229
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.38676
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1229
 
 

Population Genetic Test Statistics

Pi
297.581924
Theta
181.29883
Tajima's D
2.072502
CLR
0.796564
CSRT
0.894605269736513
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号