SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16314
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.792
 

Sequence

CDS
ATGACACTGGTTGCATCGCAAAGCATTGTTAAGATCCAAACAGACCTATCGGATCCTTTTAGAACCCATGATGGACTAAGGCAGGGTGATGCCCTCTCCTGCCTTCTTTTCAATGTTGCACTCGATAAGTGTATCCGTGACTCAGCAATAGAGACGACGGGCAATATATATTACAAATCCGCTCAAGTACTGGGATATGCGGATGATATTGACGTCATTGGCAGATCAGCTCTCGCAGTAGAAAGTGCGTACCTTGCTCTCGAGGCCTCGTCTCTCGAAGCCGGTCTCCAAGTAAACGCAGACAAAACTAAATTCCTGAGGGTGTCGAGGGACTTACGTGAGGACACAGCGCATAAAAATATTGGCCAGCATACTTTTGGATCTGTGAATGAATTTGTATATCTTGGTTCTCTGATAACGAATAATAATAATATAACAGCAGAAATAGTTAAGAGAATACTGTCGGCGAATAAATGCTACTTCGGCCTGCTTAAATATTTCTGTTCCAAAATTCTGTCACGAAATATCAAAATTCTTTTATACAAGACCCTACTGAGACCCATTCTTATTTATGGCTCAGAGACATGGGTACTCAGCAAAAAAGATGAGAACCGGCTACTTGTGTTCGAGCGTAAGATTCTAAGACGGATATTCGGTGCTGTGCGGGAAAACCAGATATGGAGGACGCGCTATAACCACGAGTTGTATGATGTTTACAAAGATCCTAACATCATAACAACTATAAAGATTGGACGCCTACGATGGGCAGGACATGTGGTTCGAATGGAGAGTACCAGAATGCCAAGACAATTGCTCTATGGCAAACCAGAGGGCCGCAGAAGTCGTGGCAGACCCAAACTTCGATGGTTGGATGGCGTGGAGCGCGACCTCAAAAATATCGGCGTCAAGAACTGGAAGGAGAAAGCCCTGAACAGAGCAGTCTGGAGAGACATACTGGACCAGGCTAAGGCCCACCCTGGGCTGTAA
Protein
MTLVASQSIVKIQTDLSDPFRTHDGLRQGDALSCLLFNVALDKCIRDSAIETTGNIYYKSAQVLGYADDIDVIGRSALAVESAYLALEASSLEAGLQVNADKTKFLRVSRDLREDTAHKNIGQHTFGSVNEFVYLGSLITNNNNITAEIVKRILSANKCYFGLLKYFCSKILSRNIKILLYKTLLRPILIYGSETWVLSKKDENRLLVFERKILRRIFGAVRENQIWRTRYNHELYDVYKDPNIITTIKIGRLRWAGHVVRMESTRMPRQLLYGKPEGRRSRGRPKLRWLDGVERDLKNIGVKNWKEKALNRAVWRDILDQAKAHPGL

Summary

EMBL
FJ265555    ADI61823.1    PYGN01000613    PSN43351.1    PYGN01000119    PSN53667.1    + More
GBBI01004263    JAC14449.1    GBHO01016952    JAG26652.1    GBBI01004261    JAC14451.1    GBRD01000202    JAG65619.1    GBRD01011073    JAG54751.1    IAAA01017080    LAA06072.1    PYGN01000254    PSN50032.1    GBBI01004262    JAC14450.1    NEVH01016288    PNF26362.1    GDAI01000742    JAI16861.1    GGFJ01005240    MBW54381.1    QOUI01000020    RCK67885.1    IAAA01017079    LAA06070.1    GGFL01003846    MBW68024.1    GGFL01003845    MBW68023.1    GGFK01003183    MBW36504.1    CH902961    KPU72636.1    RAPH01000014    RNL66055.1    GGFK01002192    MBW35513.1    CH905131    KPU81852.1    GGFK01002196    MBW35517.1    HACL01000173    CFW94467.1    CH902619    KPU76535.1    GGFK01001798    MBW35119.1    GGFK01003613    MBW36934.1    GGFK01005184    MBW38505.1    GDHC01021627    JAP97001.1    GGFK01001949    MBW35270.1    CH902653    KPU74858.1    CH902657    KPU75308.1    AZNE01000717    KID80942.1    CH902621    KPU81727.1    CH902626    KPU79149.1    CH904714    KPU81814.1    PYGN01000372    PSN47498.1    KU311054    ALX81665.1    GAPW01000199    JAC13399.1    GAKP01022638    GAKP01022636    GAKP01022635    JAC36314.1    LBMM01005351    KMQ91586.1    GBBI01004199    JAC14513.1    GBRD01017846    JAG47981.1    PYGN01000106    PSN54154.1    GECL01001585    JAP04539.1    GALA01001775    JAA93077.1    PYGN01000287    PSN49259.1    GBBI01004198    JAC14514.1    PYGN01000629    PSN43121.1    AJVK01001578    GBHO01037470    JAG06134.1    PYGN01003402    PSN29545.1    GBHO01037471    GBRD01009355    GBRD01009354    GDHC01014856    GDHC01007898    JAG06133.1    JAG56469.1    JAQ03773.1    JAQ10731.1    GBGD01000331    JAC88558.1    QOIP01000003    RLU25142.1    CH902714    KPU81861.1    CH902633    KPU74667.1    CH902666    KPU74610.1    CH902618    KPU79125.1    CH902622    KPU75266.1    KPU77326.1    CH902630    KPU77522.1    CH902627    KPU74872.1    CH902623    KPU72899.1    CH902628    KPU75346.1    GAPW01000120    JAC13478.1    PYGN01000510    PSN45119.1    UZAG01001147    VDO10529.1    PYGN01000836    PSN40188.1    QOIP01000009    RLU18885.1    CH963259    KRF97428.1    PYGN01000451    PSN46127.1    GGMR01000126    MBY12745.1    PYGN01000203    PSN51319.1    PYGN01000047    PSN56294.1    GECL01002632    JAP03492.1    GGMR01014652    MBY27271.1    PYGN01000020    PSN57453.1    GGMR01006433    MBY19052.1    HE799691    CCH14900.1    PYGN01000070    PSN55417.1    NEVH01026393    PNF14276.1    PYGN01000324    PSN48495.1    PYGN01000078    PSN55011.1    PYGN01001004    PSN38555.1    PYGN01000064    PSN55609.1    PYGN01000219    PSN50892.1    GECZ01011079    JAS58690.1    GECU01035086    JAS72620.1    GGMR01016675    MBY29294.1    GAPW01000107    JAC13491.1    ABLF02066124    GECU01011157    JAS96549.1    PYGN01001382    PSN35227.1    PYGN01000136    PSN53184.1    PYGN01000212    PSN51056.1    GGMR01000301    MBY12920.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
328
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02161
Exp number, first 60 AAs:
0.00011
Total prob of N-in:
0.01456
outside
1  -  328
 
 

Population Genetic Test Statistics

Pi
301.86422
Theta
213.861178
Tajima's D
1.293667
CLR
0
CSRT
0.738463076846158
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号