SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16300
Pre Gene Modal
BGIBMGA010729
Annotation
hypothetical_protein_AB894_15365?_partial_[Piscirickettsia_salmonis_LF-89_%3D_ATCC_VR-1361]
Location in the cell
Nuclear   Reliability : 2.818
 

Sequence

CDS
ATGTCAAAGTCAAGTACAGGTAGAGGTAAAAATAATAAAACACGTGAACGTTCTCCGAATCCTGGACTGTACCAACAACTTCAAGCGATTGTATCTCGCCTGAATGCGTTGGAAGACAATTCAAGGTCTGGTATAGCGACTGTTGTTGAGAGGCAGCCTGCGGTGGAGTCATCGGGATCGGCGGGCAGTGCTGTGGTGCCGTGCGTGGTTTTGGCTTCTGAGCAAAGCACGACACCGCCATTGGTGCCTACGCCGGTTCCACGAGTTTCCGCTGACGATTGCGTCGCTGCCGAGGTAGCCGGTAAAATTGTAAGAGCAATTAATGAATTGAATCTGGTAAGGCCGAACCATATTTATATATCAAACTTTGATCCCGATTTAAATGATATTAATGTTTGGTGTGATGAAGTTGATCATGCACGTGTCATTTATAGGTGGACCGATAGGGAGTGCTTATCTCATATTGGTAATTGCCTTAAAGGCGATGCTCGTGTGTGGTTAAATGAATGGGTCACCAATGACCGTAGCTGGTCTAATTTTAAACGCGAGTTTAAGCCGTTGTGTCCCCGTCGGGTAGATGTTGCAAATATCCTTTTTGATGTTATGAAAACCGATTCCAACAACTATCCTACATACGCGGAATATGTTAGGCGATCTTTATTGCGTCTTCGTATAGTAAATGGACTTAGTGACGAATTAGTTTCAGCAATAGTGATCCGGGGTATCGTTGATCCACAAATTCGTGCGGCCGCTACAAACGCGAGGTTATTGCCTAACGATTTAGTTGAGTTTTTCTCCATATATGTAAAACCTACACCTCAAACAAAAACAAATCATAATACTCGTACTGTCGCTGGTCGCTTTCATAATACACAATTCTCATCACGTAAAAGAGAGCATAGTTCTAGTAGAACCGGTTGTTACGTATGTGGATCATTTGGCCATAGACAAGTGAATTGCCCTAAGCGAACGAGAAAACGTTCGCCTACTGTGAATGATAGATTCACATCTGTACCCGCTGCCAGCTCCTCTGTGCAGAAGCCTGAACCTTGTTCTTTTTGTAAAAAGCTGGGCCATAAAGTAGAGCAGTGTTTCTTTAAGCAGCGTTCTGAAGCTCGTGGAAAATCTAACGTGAATTTTTGCCGTGATACTGTAAATGACTATAGAAAAAATGATATAGCTACTGCGATCGTACAGGGTGTACCAGTCGATATCCTGATAGATAGTGGATCCACAGTCTCGCTTATGTCTGAATCAATTGTAAAACATTTTCAATGTAAACGAGTACCCTCATTTTGCGTGTTACGAGGAATTGGTGACTGTGACACTGAATCTCACTATTTTACTACTTTGACAGTTGAGTTTCCCGAAATTACGCTAGAAATAGACTTTCAAATTGTTAGTGACAAGTTCATGAATACCCCAGTCATAATCGGTACTGACGTTTTGAATCGGGAAGGTGTCACGTATATTAGGAAAAAGGGCATACAGCGCTTAACTCGGGTAGAAAAGGTTTTTACTGCTGAGACAACTGAACTTAATTCAATCCCTACCGTGAATACTTCATTAACAGGTGAAGAAAAAAATAAATTATTAGCTTTGGTACGAAAATTTTCAAAATACCTTATAACTGGTACCGCGGCCAGTACTGTTACAACTGGATCCATGCAAATTCGACTCAGCAATGAAACTCCTATTGTTTACAGACCTTACAAATTATCATTTAGCGAAAAACTTCGCGTTAGAGAAATTATTAAGGATCTTCTTGATAAAGGTGTGATTAGGGAGTCTGAATCGGAGTTCTCGAGTCCGATATTGCTAGTTAAGAAAAAGGACGGCAGTGACAGGATGTGCGTGGACTTTCGGGCTCTTAATGCGAATACTGTGAAGGATCGCTATCCATTGCCGTTAATAGACGATCACATTGACCGGTTAGGTAGCGCAAAATATTTTACAAGCCTCGATATGGCCACTGGTTTCCACCAGATTCCTTTAGCAAACGACTCCATTCACAAAACCGGCTTTGTGACACCCGAAGGTCATTTTGAATACCTTAAAATGCCCTACGGGTTAGCCAATGCCCCGGTTGTTTATCAACGTATTATAACTAATACTCTGAAAGCCTTTAGTGAGACAGGGAGGGCTTTAATATATATCGATGATGTTTTAATACCTAGTCAGACCATTGATGAAGGCCTAAATACTCTGCGTGAAATCTTTGAAACACTAACTAAGGCGGGCTTCTCGATTAATTTAAAAAAATGCAAGTTTCTTGCTAACGAAATTGAATATTTGGGCAGAACTATCAGCAATGGTCAGGTTAGGCCGAGTACGTATAAAGTAGAAGCATTGACAAGAGCCCCGAAGCCTGGTAATGTTAAACAAGCTAGACAATTTTTAGAAGTACACACTGATGCTTCTTCTCGAGGGTATGGAGCTGTTTTACTTCAGACTCATGGGAATAATAATAAACGCGTGGTGGGATATTTTAGTAAAGTTACCCAAGGCGCCGAACCACGCTATCACTCCTATGAGCTGGAGACACTCGCTGTGGTCAAGGCTCTGCAGCATTTCAGGCACTACCTCATAGAAGTTTTGTGGAAACTGCAGCTCACCCTGAACGTTACGAAACAAAAGTCCACTCAATATTCACCTTTATATTTGTTAATTGGTAGCGATGCTGTGACGCCCGTCATTCGTTCCGTTGTACGCGATGTGGCTCTAGAAGGAACAAGTGCCAACAGAGAAACCTTACGCGAGCTTGCCCGACAAAGAGCTTCTCAACTGCTGGACAAAAACCGAAAACAGCAGGACACTCGAGTAAATGAACGGCGCAAACCCCCGCGTACTTTCCATGAAAACGACGTGGTCTTCGTGCATAAGAATAGCCAATCTGTTGGAAAGCTGGATTCTGGTATGCGTGGCCCGTACAAAATAGTGCGTGCGCTGCCACATGGACGTTATGAACTGAAGCTTCTTTCTGGCTCACTTGGGAAGACCACGGAAGCTGCTGCCGAATTTATAAGTGCGTGGCACGGAGAGTGGACGCCGGATGTGTGCACCGCATTTTTCGAGTGTGATGAGAATAGCTCTGAGGAAGGTATTGTCGCCGGTCCATCACACCACCATGACGACATAGTACCTCTAGACGGACCTATTAATGCGGGCGAGGACGCTCCGCCGTCAGGAGAGGCCGTGTTAGAAGATGATGATGACATTGGAGGCGTGGCCTAA
Protein
MSKSSTGRGKNNKTRERSPNPGLYQQLQAIVSRLNALEDNSRSGIATVVERQPAVESSGSAGSAVVPCVVLASEQSTTPPLVPTPVPRVSADDCVAAEVAGKIVRAINELNLVRPNHIYISNFDPDLNDINVWCDEVDHARVIYRWTDRECLSHIGNCLKGDARVWLNEWVTNDRSWSNFKREFKPLCPRRVDVANILFDVMKTDSNNYPTYAEYVRRSLLRLRIVNGLSDELVSAIVIRGIVDPQIRAAATNARLLPNDLVEFFSIYVKPTPQTKTNHNTRTVAGRFHNTQFSSRKREHSSSRTGCYVCGSFGHRQVNCPKRTRKRSPTVNDRFTSVPAASSSVQKPEPCSFCKKLGHKVEQCFFKQRSEARGKSNVNFCRDTVNDYRKNDIATAIVQGVPVDILIDSGSTVSLMSESIVKHFQCKRVPSFCVLRGIGDCDTESHYFTTLTVEFPEITLEIDFQIVSDKFMNTPVIIGTDVLNREGVTYIRKKGIQRLTRVEKVFTAETTELNSIPTVNTSLTGEEKNKLLALVRKFSKYLITGTAASTVTTGSMQIRLSNETPIVYRPYKLSFSEKLRVREIIKDLLDKGVIRESESEFSSPILLVKKKDGSDRMCVDFRALNANTVKDRYPLPLIDDHIDRLGSAKYFTSLDMATGFHQIPLANDSIHKTGFVTPEGHFEYLKMPYGLANAPVVYQRIITNTLKAFSETGRALIYIDDVLIPSQTIDEGLNTLREIFETLTKAGFSINLKKCKFLANEIEYLGRTISNGQVRPSTYKVEALTRAPKPGNVKQARQFLEVHTDASSRGYGAVLLQTHGNNNKRVVGYFSKVTQGAEPRYHSYELETLAVVKALQHFRHYLIEVLWKLQLTLNVTKQKSTQYSPLYLLIGSDAVTPVIRSVVRDVALEGTSANRETLRELARQRASQLLDKNRKQQDTRVNERRKPPRTFHENDVVFVHKNSQSVGKLDSGMRGPYKIVRALPHGRYELKLLSGSLGKTTEAAAEFISAWHGEWTPDVCTAFFECDENSSEEGIVAGPSHHHDDIVPLDGPINAGEDAPPSGEAVLEDDDDIGGVA

Summary

Pfam
PF00078   RVT_1        + More
PF00665   rve
PF00077   RVP
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF03732   Retrotrans_gag
PF00098   zf-CCHC
PF02037   SAP
PF17917   RT_RNaseH
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR001969   Aspartic_peptidase_AS       
IPR001584   Integrase_cat-core       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR000477   RT_dom       
IPR018061   Retropepsins       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR005162   Retrotrans_gag_dom       
IPR036361   SAP_dom_sf       
IPR041373   RT_RNaseH       
IPR003034   SAP_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=1.08692e-47,     Score=483

Ontologies

Topology

Length:
1077
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00899999999999999
Exp number, first 60 AAs:
0.00032
Total prob of N-in:
0.00039
outside
1  -  1077
 
 

Population Genetic Test Statistics

Pi
2.850221
Theta
24.90555
Tajima's D
-1.503966
CLR
171.270737
CSRT
0.0585470726463677
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号