SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16297
Pre Gene Modal
BGIBMGA002240
Annotation
PREDICTED:_uncharacterized_protein_LOC106717303_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.648
 

Sequence

CDS
ATGAAGCCTCTGTCAAAACTTGAAATGCAGTGTGAAGAGCATTTTAAGAAAACTCACACTCGAAACACTGACGGTCGATATGAGGTTCGCCTACCCTTCAAGGACGAAGACGCTCCAAATTTAGGCAACTCCAGACAACTTGCTTTGAAACGCTTACATCAGATGGAGAATAAGTTTAAGCGAAGACCCGAGTTTCACGAAGAATACAGCAAGTTCATGAGACAATATGAGTCACTCGGTCACATGGAGGTCGTCCCTGAAACAGAGAAGACGAATAGAGCTTATCACCTACCACATCATGCTGTTCTTCGTGCCTCGAGCCTCACTACAAAGTTGCGCGTAGTATTTGACGGAAGCGCTAAGCCTGTAGACGGAAACTCACTTAACGATGAGTTACTCATCGGCCCACCGCTGCAACAAGATATACGAGATTTAGTAACACGGTGGAGACAACATAAGTACTGCCTAGTAGCTGATATACAACACATGTACCGACAGATACTTATTTCAAAGCAAGACACTGATTACCAGAGAATCTTGTGGCGCGAGTCATCGGAAGACCCGATTAGAGAATATCGGTTACTTACCGTCACATATGGCAGTTCATGTGCTCCATATCTTGCTATAAGGACACTTCATCAACTTGCAGAGGACGAACGTGGAAAGTTTCCTGAAGCTGAACTTCTAAAAACTGATCTCTATATGGACGATTTGATGACAGGCTCATCTACAGAAGAAGACACTCAACGGCTTCAACGTCGCTTAACTGAACTGTTTAAACGTGGCGGTTTTCTTCTACACAAGTGGTCGTCTAATAGTGAAATAGTTTTAAATGAGATTCCCGATTCGATAAAAGCATTAAAAGGTTCAGTGAATATTAAAATGGATGATTCGGTGAAAGCTCTGGGTATAGCCTGGAAACCTCAAAGTGATATATTTGAACTGGTAGTTAACTTACCTCATGACAACGACGTTGTTACAAAACGAAGTGTGCTATCTGCGATAGCAAAAACTTTTGACCCTCTGGGTTGGCTAGCACCTTGCGTGATTGTGTTAAAAATGTTTATGCAGAAGTTGTGGCTGGCCGGCCTGGACTGGGACTCTGAACTTCCTGAAGACTTGAAAACTGAATGGCAGAATTACCTGACTAATTTTGAACACATGCAGGCCATTCAGCTTCCACGTTGGCTAGGGATTTCAAATAATGTCAAAATTGAATTGCACGGCTATTGTGACGCCTCTTGCGCCGCCTACGCTGCGGTTATTTACATCAGAGTAATCACGGACAATGAGATAAAAGTAAGTCTAGTCGCAGCCAAAACAAAGGTCGCTCCCGTTAAACAGATCTCATTGCCACGTCTTGAACTTTGTGGGGCAGTCTTATTGTCTAAATTGATACCATATGTCAAATCTAGTCTAAATATTGATGATAATTGTGTATTTGCTTGGACAGATTCCACAATAGTTTTGGCTTGGTTGCGTAAAACTCCAAATACTTGGAAGCCATTCGTTGGTAATCGCACTACCGAAATCTTGAATGTTACGAATAGCAGTCAATGGCATCATATTAAGTCTGCGGATAACCCCGCGGACTGCGCTTCACGCGGTATCAGTCCTGGCGAGCTGATGCAGTCACAACTATGGTGGGAAGGTCCAGCCTTTCTTCGCGAGTCTGTTGAGATTCGTTACCCTGATTTCACTATACCTGAAACCACACTCGAAGCAAAACCGAAAGCAAAAGTTAGTTACTTATGCACCTCTGAACCCAATGAATGTACTATGTACCTCAATAGATACTCAAATCTACTTAGACTTATACGTGTGACAGCCTATTGCTTTCGATTTTTGCGACTATGTAAAGATAAGGCTCTTAAAAGGAACGATAACATAAAACTGACATACCTCACTACTGATGAAATAAAAAATGCATTAAAAACTTGCATACGAATGTCACAGTCTGTTTACTTTAAAAGTGAAATAGGATTGTTATCACAGAGCAAACCTATCCCAAAAAATAGTAAACTTTTACCTTTGAATCCGATCCTAGACAATGAGAAAATTATTAGAGTCGGTGGACGTCTTGTAAATGCTCAAATACCACCTGATATGAAGTCTCCTATAATCTTACATCACAAATGTAACTTAGCAAAGTTGATTGTAATTGATGCTCATTTGAGAACACTACATGGTAGAAATTCGCTCACATTAAATGTTGTCCACCAAAAATATTGGATTCTCCGAGCAAAGAACTTAGTAAAAAAGATTTTAAGATTATGTAAACCTTGTTTTACCCAAACTGCACGACCTATGACTCCGTTAATGGGTAATTTACCACAGTGCAGAGTCAATCCGTCACGCCCGTTTTTGACCAGCGGCGTAGACTTTTGTGGTCCATTTACGCTGAAACTGTACTCTGGTAGATGCACCAAAACTTGTAAAGCTTACATAGGTGTGTTTTTATGTATGGTTACAAAGGCTATTCACCTTGAGCTGGTTAGTTCACTATCCAGTGCTGCGTTTTTAGCAGCCTTCAAACGTTTTACTTCCCGACGTGGGCATTGTAAAGACATCTGGAGTGATTGTGGGACTAACTTCATAGGCGCGTCCAAAGAATTGGATCTCGCCTTCAAAAACAGTAAATCCACTGTCGTTGACGAAATCGCCCAACTGTTAGCTAACGACAGCACAACATGGCATTTCATTCCCCCTGGTGCCCCTCACTTTGGAGGATTGTGGGAGGCAGGAGTTAAGTCCGTAAAAGGACATTTGAAACGTGTCGTAGGCGAGTCCTGCTTAACATTCGAAGAGTTTTGCACTCTGACCACACAGGTCGAGGCTTGTGTCAACTCTCGGCCTCTTACGTTGATTAGTTCTGCCGTTGATGAACTCCCGTTGACTCCTGGTCATTTTTTGATCGGCGAAGCACCGGTTACTATCCCTGAAGAAAGTTTCGTGGATACTCGACCTGACTATTTAAACCGATGGCAAAAGGTGCAACGTATGGTACAAAGTCTGTGGCGACGCTGGCAATCTGAGTATCTTACTATGTTGCAACATCGATACAAATGGTCCCAGAACCACCCCGACATAAATGTTGGTACGGTTGTCTTAGTGAAAGATGATCGTTTACCTCCAGGTAAATGGCTTTTGGGACGAATCGTGGCGAAGCACCCGGGAGCAGACGGTGTAACGCGTGTAGTCTCCTTACAATTTAAGGATCGTGTATTTAAGAGACCAGTTACTAAACTGTGCCCTCTGCCTCTAGCTGCTTCAGAACCTTAG
Protein
MKPLSKLEMQCEEHFKKTHTRNTDGRYEVRLPFKDEDAPNLGNSRQLALKRLHQMENKFKRRPEFHEEYSKFMRQYESLGHMEVVPETEKTNRAYHLPHHAVLRASSLTTKLRVVFDGSAKPVDGNSLNDELLIGPPLQQDIRDLVTRWRQHKYCLVADIQHMYRQILISKQDTDYQRILWRESSEDPIREYRLLTVTYGSSCAPYLAIRTLHQLAEDERGKFPEAELLKTDLYMDDLMTGSSTEEDTQRLQRRLTELFKRGGFLLHKWSSNSEIVLNEIPDSIKALKGSVNIKMDDSVKALGIAWKPQSDIFELVVNLPHDNDVVTKRSVLSAIAKTFDPLGWLAPCVIVLKMFMQKLWLAGLDWDSELPEDLKTEWQNYLTNFEHMQAIQLPRWLGISNNVKIELHGYCDASCAAYAAVIYIRVITDNEIKVSLVAAKTKVAPVKQISLPRLELCGAVLLSKLIPYVKSSLNIDDNCVFAWTDSTIVLAWLRKTPNTWKPFVGNRTTEILNVTNSSQWHHIKSADNPADCASRGISPGELMQSQLWWEGPAFLRESVEIRYPDFTIPETTLEAKPKAKVSYLCTSEPNECTMYLNRYSNLLRLIRVTAYCFRFLRLCKDKALKRNDNIKLTYLTTDEIKNALKTCIRMSQSVYFKSEIGLLSQSKPIPKNSKLLPLNPILDNEKIIRVGGRLVNAQIPPDMKSPIILHHKCNLAKLIVIDAHLRTLHGRNSLTLNVVHQKYWILRAKNLVKKILRLCKPCFTQTARPMTPLMGNLPQCRVNPSRPFLTSGVDFCGPFTLKLYSGRCTKTCKAYIGVFLCMVTKAIHLELVSSLSSAAFLAAFKRFTSRRGHCKDIWSDCGTNFIGASKELDLAFKNSKSTVVDEIAQLLANDSTTWHFIPPGAPHFGGLWEAGVKSVKGHLKRVVGESCLTFEEFCTLTTQVEACVNSRPLTLISSAVDELPLTPGHFLIGEAPVTIPEESFVDTRPDYLNRWQKVQRMVQSLWRRWQSEYLTMLQHRYKWSQNHPDINVGTVVLVKDDRLPPGKWLLGRIVAKHPGADGVTRVVSLQFKDRVFKRPVTKLCPLPLAASEP

Summary

EMBL
ODYU01008608    SOQ52337.1    KQ458473    KPJ05885.1    KQ460036    KPJ18393.1    + More
LBMM01007859    KMQ89359.1    LNIX01000002    OXA59522.1    LBMM01009551    KMQ88039.1    GEZM01060254    JAV71154.1    LNIX01000007    OXA51795.1    OXA60848.1    LNIX01000016    OXA46198.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    LBMM01010405    KMQ87487.1    LNIX01000069    OXA36894.1    LBMM01012188    KMQ86362.1    LBMM01009688    KMQ87939.1    LBMM01008464    KMQ88855.1    LBMM01008324    KMQ88972.1    KK114194    KFM61875.1    LNIX01000036    OXA39969.1    LBMM01006539    KMQ90520.1    LBMM01009964    KMQ87756.1    LBMM01010417    KMQ87475.1    NWSH01000070    PCG79985.1    LBMM01009645    KMQ87967.1    LBMM01009888    KMQ87813.1    OXA51382.1    LBMM01006490    KMQ90572.1    LNIX01000003    OXA58579.1    LNIX01000001    OXA61293.1    LNIX01000044    OXA38660.1    GAMC01003146    JAC03410.1    AY180917    AAN87269.1    LBMM01005079    KMQ91831.1    GBGD01000063    JAC88826.1    ABLF02022040    ABLF02056888    GGMR01002340    MBY14959.1    GFTR01008874    JAW07552.1    ABLF02041590    GEZM01021505    JAV88969.1    GBBI01004211    JAC14501.1    LBMM01009941    KMQ87772.1    JXUM01113346    KQ565681    KXJ70776.1    JXUM01030959    KQ560903    KXJ80414.1    GEZM01013098    JAV92753.1    ABLF02005684    ABLF02042806    LBMM01010986    KMQ87097.1    LNIX01000005    OXA54454.1    GBBI01004032    JAC14680.1    GGMR01020322    MBY32941.1    ABLF02042264    LNIX01000018    OXA45284.1    GAKP01010103    JAC48849.1    LNIX01000011    OXA48427.1    GL769615    EFZ10365.1    LBMM01011283    KMQ86917.1    GGMS01010524    MBY79727.1    LBMM01009210    KMQ88303.1    ABLF02013940    ABLF02036313    ABLF02066938    ABLF02066950    ABLF02039606    GGMR01010750    MBY23369.1    GGMS01004301    MBY73504.1    GEZM01066272    JAV68024.1    EF426679    ABP48078.1    QOIP01000003    RLU24775.1    ABLF02041863    GGMR01018506    MBY31125.1    U23420    AAB03640.1    ABLF02065856    GGMR01005535    MBY18154.1    AAGB01000056    EAL58741.1    GGFL01004049    MBW68227.1    GGMR01013370    MBY25989.1    GEHC01000898    JAV46747.1    GGMS01009443    MBY78646.1    AJ487856    CAD32253.1    ABLF02041731    ABLF02023842    ABLF02028949    ABLF02058391    ABLF02025193    GBHO01020765    GBHO01014531    JAG22839.1    JAG29073.1    ABLF02008636    ABLF02065931    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GANO01004788    JAB55083.1    CR954257    CAJ14165.1    GGMR01018294    MBY30913.1    GEZM01018702    JAV90048.1    GEHC01000894    JAV46751.1    GEHC01000864    JAV46781.1    GALX01004947    JAB63519.1    GGMR01014165    MBY26784.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    GEZM01018619    JAV90138.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05585   DUF1758
PF03564   DUF1759
PF05380   Peptidase_A17
PF18701   DUF5641
PF00665   rve
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00230   MIP
PF12259   Baculo_F
PF02145   Rap_GAP
Interpro
IPR001584   Integrase_cat-core        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR001995   Peptidase_A2_cat       
IPR000727   T_SNARE_dom       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR000425   MIP       
IPR023271   Aquaporin-like       
IPR022048   Envelope_fusion-like       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
IPR013087   Znf_C2H2_type       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF81338   SSF81338       
SSF111347   SSF111347       

Ontologies

Topology

Length:
1093
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12191
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00034
outside
1  -  1093
 
 

Population Genetic Test Statistics

Pi
376.218194
Theta
192.866422
Tajima's D
3.086891
CLR
0.381607
CSRT
0.983100844957752
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号