SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16283
Annotation
PREDICTED:_uncharacterized_protein_LOC106133664_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.736
 

Sequence

CDS
ATGAAACCGAATCCTTGCTTAGAAAAAAACTGTCCCTACAAGTGTCAAGAAATAACCTCAGAAAAAAGGAGTGCCATATTTAAACATTTTTGGGAATTATCTCCGGAAAGAAAAAAGCTGTGGATAATATCTATGTCCTCTAAGCAATCCATAAAAAGGAAGAGATCCAAAGACTCTAATTACAGGAATAACACATTTTGTTATTTCATAAATGATGGAGAGGGTCGGCGACAAGTTTGTTTAAAGTTACTCATGAATACTCTTGATGTCACTCAAAGATACATTTATTATACATTAACAACACAGGAACTTGGTATGGCGAAAGAAAATGGAAGAGGAAAATGCATTCCCCCCAACAAAACATCTAACGCAATCAAAGAATCAGTAAAATCTTTTATCAAAAGGTTACCTGCAATACCATTGCACTACTGCCGAAAGGATAGCACAAAACTATATCTGCCTGTTGAATTTAAAAATATAAAAAAATTATACCGCTGTTATAAAGAAGACCTCATTAGTAAAGGAGTCGATGTTGTAAGTGAAAAAGTATTCCGTCAAATATTCACTACTGATTTTAACATTGGGTTTCATGTGTCTAAGAAGGATAAATGCATAAAATGCCTACGTTTTGAAGGACAGAAGCCAGAGGATTGTGCCGAATTTCAAGATCATTTAGAGGAAAAGAAGGCATCAAAGAAGCGGTTAGAATGTCATCGACAGTTAGGTAAAGAAAATCCTTCCATTCTGTGCACATCTTTTGACCTCCAGAAAGTTCTCAATACGCCTCATGGCAATAACATGTTACTATTTTATTCTAGAAAGTATGCTGTTTATAATTTATGTTTTTATGAAAGCATCACAAGGAATGGTTTTTGTTTTATCTGGGGAGAATCTGAAGCAAAGAGGGGCGCAAATGAAATTGCTACTATTATACAGAAATACATAGAGAATGTGGATTCTCGAGGTATCATTACATCTTTGATCTTGTATTCAGATTCTTGCCCTGGACAAAACAAAAATAAAATAGTCCTTGCAACAATACATAATGCTTTGTTGCAATCGAACAATTTACAAGCAATTCAAATGAATTACCTTCTCCGTGGCCACACGGAAATGTCGGTAGACAGCATACACTCTACAATCGAACAATCCGTAAGAAATATTACTGTATGGGCCCCTTCGCAATGGGCTACAATAAGCCAGCTAGCAAGAAAAGAACCAGCACCTTATAATGTTGAAAATCTGACACACGAGGATTTCTTAAATTTTGATGATATGTCAGAAAAATATTTTAAGGGTAACCTTGTAGGTAAAATTAGTAAAATCCGTACAGCAACATTTAAAAAATCTCATCCAAATCAAATGAAAGTAAAATTTTCAATGAAAGATAATGCATCCGAAGAGATTATACAAATTATTGCGAAACCTAGAGCTATCAATCGTAGATATAATTCAAGTTTGCCGATTACCAAAGCCAAATACATGGACCTAAAGAAATTGTGTGACACTGGGGTTATACCCAAGATATTTCATAAAGAATACATAAATCTATAA
Protein
MKPNPCLEKNCPYKCQEITSEKRSAIFKHFWELSPERKKLWIISMSSKQSIKRKRSKDSNYRNNTFCYFINDGEGRRQVCLKLLMNTLDVTQRYIYYTLTTQELGMAKENGRGKCIPPNKTSNAIKESVKSFIKRLPAIPLHYCRKDSTKLYLPVEFKNIKKLYRCYKEDLISKGVDVVSEKVFRQIFTTDFNIGFHVSKKDKCIKCLRFEGQKPEDCAEFQDHLEEKKASKKRLECHRQLGKENPSILCTSFDLQKVLNTPHGNNMLLFYSRKYAVYNLCFYESITRNGFCFIWGESEAKRGANEIATIIQKYIENVDSRGIITSLILYSDSCPGQNKNKIVLATIHNALLQSNNLQAIQMNYLLRGHTEMSVDSIHSTIEQSVRNITVWAPSQWATISQLARKEPAPYNVENLTHEDFLNFDDMSEKYFKGNLVGKISKIRTATFKKSHPNQMKVKFSMKDNASEEIIQIIAKPRAINRRYNSSLPITKAKYMDLKKLCDTGVIPKIFHKEYINL

Summary

EMBL
ABLF02010023    ABLF02004257    ABLF02029811    ABLF02018334    ABLF02012672    ABLF02014818    + More
ABLF02014820    ABLF02012895    GEZM01058056    GEZM01058054    GEZM01058052    GEZM01058051    GEZM01058048    JAV71930.1    GGMR01020048    MBY32667.1    ABLF02007876    ABLF02009246    ABLF02009249    ABLF02012670    ABLF02012673    ABLF02042537    ABLF02044751    AAGJ04019135    AAGJ04019136    AAGJ04019137    AAGJ04087115    AAGJ04159061    ABLF02008707    ABLF02008709    RSAL01000569    RVE41377.1    KB200426    ESP01684.1    ABLF02010195    ABLF02010196    ABLF02055224    ABLF02026661    ABLF02026674    ABLF02026675    ABLF02041813    ABLF02060074    ODYU01004805    SOQ45064.1    RSAL01005524    RVE40000.1    AAGJ04148968    ABLF02010095    ABLF02023797    RSAL01000142    RVE46021.1    ABLF02037175    ABLF02037177    AAGJ04142602    ABLF02004635    BABH01025621    GBHO01042097    JAG01507.1    ODYU01004340    SOQ44104.1    ABLF02024894    ABLF02024897    ODYU01011180    SOQ56761.1    ABLF02009832    ABLF02009835    RSAL01000210    RVE44232.1    ABLF02022524    ABLF02019640    ABLF02019643    ABLF02019649    RSAL01000260    RVE43346.1    GGMR01008791    MBY21410.1    ABLF02013766    GGMR01008668    MBY21287.1    ODYU01012570    SOQ58975.1    ABLF02013311    RJVU01027735    ROL48958.1    ABLF02039177    KB202199    ESO91835.1    ABLF02003967    ABLF02033230    ABLF02004032    ABLF02042646    ACPB03009534    GEZM01027265    JAV86789.1    NWSH01003159    PCG66844.1    GGMR01018884    MBY31503.1    RSAL01000009    RVE53882.1    ABLF02015617    ABLF02015622    ODYU01009390    SOQ53782.1    KK107242    EZA54533.1    MRZV01000115    PIK58358.1    LNIX01000005    OXA53581.1    AMQN01021160    AMQN01021161    KB298212    ELU09529.1    AAGJ04162991    ACPB03016567    ACPB03016568    GAKP01007365    JAC51587.1    UFQS01001897    UFQT01001897    SSX12663.1    SSX32106.1    GEZM01023604    JAV88283.1    GECZ01029139    JAS40630.1    ABLF02020246    ODYU01002004    SOQ38964.1    KK107128    EZA58416.1    KZ150145    PZC72904.1    RQTK01001146    RUS71879.1    BABH01033861    RSAL01000213    RVE44164.1    LNIX01000025    OXA42761.1    GBXI01005713    JAD08579.1    ABLF02021172    GGMR01004875    MBY17494.1    GEZM01010383    JAV94073.1    LNIX01000029    OXA41441.1    GGMR01003297    MBY15916.1    GECU01006037    JAT01670.1    AAGJ04038612    AAGJ04038613    LNIX01000016    OXA46212.1    GEBQ01029058    JAT10919.1    ABLF02006015   
Pfam
PF00078   RVT_1        + More
PF01192   RNA_pol_Rpb6
PF13359   DDE_Tnp_4
PF16064   DUF4806
PF04500   FLYWCH
PF10551   MULE
PF04218   CENP-B_N
PF14033   DUF4246
Interpro
IPR018247   EF_Hand_1_Ca_BS        + More
IPR000477   RT_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR020708   DNA-dir_RNA_polK_14-18kDa_CS       
IPR036161   RPB6/omega-like_sf       
IPR006110   Pol_omega/K/RPB6       
IPR012293   RNAP_RPB6_omega       
IPR027806   HARBI1_dom       
IPR032071   DUF4806       
IPR012337   RNaseH-like_sf       
IPR018289   MULE_transposase_dom       
IPR007588   Znf_FLYWCH       
IPR009057   Homeobox-like_sf       
IPR007889   HTH_Psq       
IPR036388   WH-like_DNA-bd_sf       
IPR025340   DUF4246       
SUPFAM
SSF63562   SSF63562        + More
SSF53098   SSF53098       
SSF46689   SSF46689       
Gene 3D

Ontologies

Topology

Length:
517
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00482
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00246
outside
1  -  517
 
 

Population Genetic Test Statistics

Pi
74.070426
Theta
25.787029
Tajima's D
4.163806
CLR
0.151153
CSRT
0.999250037498125
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号