SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16276
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.297
 

Sequence

CDS
ATGGTTAGGAACGACAGGCTCACTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAACATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGTCACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCTCCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTACTTGGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACATACCACAACCCCTAATGGCAGGCGGCTCGACGCGTTAGTCGATGATCTCGCCTTCGATATCATCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTTACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCATTTTGAAACTCGGTCGCGCTCCTGATTCCGTTCCCGTCACGAGGACAGTGGTGGATTGGCACACGCTGGGCATTAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAGCCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGCCTGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATCCGCGCTTACGATAGGTATCCTACCGTGGAAAATCGTACTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACAGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAGCTATGCCCCCCCTCGTAGGCCCCTCGGGCCGACTCGCGGCATTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGTAGAGCCTCCTTGCCACCCTTGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGATTTGATCAAAGACCTACGTCCTCGCAAAGCTCCCGGTTCCGACGGTATATCTAACCGTGTTATTAAACTTTTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTTAATGCCGCTATGGCTAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCAAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTCGTGGGACTTAACCGACCAAAACCGATCTACACGGGAGCCCTCTTCTTCGACGTCGCAAATGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTTTTCAACATGGGCGTACCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCTAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGGCTGGAGTCCCGCAAGGCTCCGTTCTTTCTCCGCTCCTATTTAGTTTATTTGTCAATGATATTCCCCGGTCGCCGCCGACCCAGCTAGCCTTATTCGCTGACGACACAACCGTTTACTACTCAAGTAGAAACAAGTCCCTAATCGCGAGTAAGCTCCAGAGTGCAGCGTTAACCCTCGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCTCCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACACCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGACCAGGAAGGTCAAGTACCTGGGAGTAACCCTGGATGCATCCATGACATTCCGTCCGCATATAAAAACAGTCCGTGACCGTGCCGCATTTATTCTCGGTAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTGCAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTCGACCTTCACGACGACCTGGGCCTCGAATCGATCCGCAAACACATGAAGTTAGTGTCGGAACGTTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGATTACTCCCCGAATCCTGATCACGCAGGAGCAAGTCACCGTCGTCGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACTCTTGCATTAGATACCTTCAGCTCTAACACTAGGAGCAGGCTGAGGAACCTCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MVRNDRLTARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIIAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVILKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFSPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLPDDIRELLRAKNASIRAYDRYPTVENRTRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYSLARTLKSDTVVAMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPLDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPKPIYTGALFFDVANAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTQLALFADDTTVYYSSRNKSLIASKLQSAALTLGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWTRKVKYLGVTLDASMTFRPHIKTVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKHMKLVSERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITLALDTFSSNTRSRLRNLGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    AB055391    BAB21761.1    U07847    AAA17752.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    ABLF02042518    ABLF02057746    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    GGMS01006359    MBY75562.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02008153    ABLF02008462    ABLF02008464    GFTR01008262    JAW08164.1    ABLF02034467    GBBI01004571    JAC14141.1    NEVH01006736    PNF36716.1    GFTR01008038    JAW08388.1    GGMS01002992    MBY72195.1    GEZM01053022    JAV74219.1    GFTR01008279    JAW08147.1    ABLF02024246    NEVH01022639    PNF18527.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    NEVH01021205    PNF19912.1    GGMR01003407    MBY16026.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFTR01008271    JAW08155.1    ABLF02041767    NEVH01016302    PNF25823.1    ABLF02028535    ABLF02028545    ABLF02029306    ABLF02029314    ABLF02060138    GGFL01004957    MBW69135.1    GFTR01008261    JAW08165.1    ABLF02023911    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01020940    PNF20481.1    KK119692    KFM76444.1    GGMR01000676    MBY13295.1    GGFL01005012    MBW69190.1    GFTR01008251    JAW08175.1    GFTR01008256    JAW08170.1    GFTR01008246    JAW08180.1    GFXV01000908    MBW12713.1    NEVH01017470    PNF24199.1    GGMR01003864    MBY16483.1    GGFJ01001844    MBW50985.1    GBBI01003810    JAC14902.1    GGFJ01001842    MBW50983.1    NEVH01026386    PNF14434.1    LBMM01013518    KMQ85605.1    GGFJ01001843    MBW50984.1    GFTR01008151    JAW08275.1    GGMS01017365    MBY86568.1    KU543685    AMS38375.1    GEZM01084969    JAV60363.1    GGMR01016905    MBY29524.1    RPOV01000134    RPJ78669.1    GBGD01000415    JAC88474.1    GGMR01000226    MBY12845.1    GFTR01008257    JAW08169.1    NWSH01000032    PCG80496.1    GGFJ01001822    MBW50963.1    GGFJ01002256    MBW51397.1    DNOY01000259    HBE18313.1    GGFJ01002257    MBW51398.1    AY060438    AAL25477.1    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    GFTR01008260    JAW08166.1    GGMS01000737    MBY69940.1    S59870    AAB26437.2    NWSH01007753    PCG62823.1    GGMR01012443    MBY25062.1    GECL01003538    JAP02586.1    GEDC01000337    JAS36961.1    GBGD01000389    JAC88500.1    AF456125    AAL57609.1    GFTR01008269    JAW08157.1    KK119261    KFM75202.1    GGMS01002955    MBY72158.1    AY180919    AAN87272.1    M22874    M38643    NEVH01019963    PNF22185.1    GGMR01012676    MBY25295.1    ABLF02040174    ABLF02040183    ABLF02055266    GGMR01006491    MBY19110.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
899
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.55832
Exp number, first 60 AAs:
0.07761
Total prob of N-in:
0.04822
outside
1  -  899
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
105.580312
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号