SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16266
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.463 Mitochondrial   Reliability : 1.268 Nuclear   Reliability : 1.476
 

Sequence

CDS
ATGAAACAGCGAAGGGAAACTGCAGATGCTGCTCCGTCAGATGGAAAAACTATAAACACTAAAATCAGAAAGCTGAGTAGGCGTGACCTTCGCCAATTCAACACAACAAAGATAAAAGAGGCAATAGAACAAAACAAAGGCACCAAAGTGTTTATACGGCAACAACAACTAGGCCGAAGCCATCTGACGAAGCTCAAAACTGCCGATGGAAGAATTGTTGACTCAAGATCAGAAGTCCTCACTGAAGTGGAGAGCTACTACTGTAGTCTCTATGCCTCACATGCTCCCAAACCCTTTGCCCACCCAGAGAATGATCACCGAGCCCCTTTAGTCCGCCACTATACGGAAGACATACCCGACGTCAGTATAGAGGAGATAAGGGCTGCTTTGGAACAGCTTAGAAAATATAACAGAGCTACAGGGGATGACGGACTCAGTACAGAATTGTTGAAAGCAAGTGGTACACCAGTTCTCAACCAATTATGTACAACGTTCAACACCGTCATCCAAAAAACGACTACACCGGAAGCCTGGAGCAAGGGTACTGTCATTCTTTTCTTTAAAAAGGGAGACCGTACTCTGCTCAAGAACTACAGGCCTATTTCACTTCTTAGCCATATTTATAAGCTGTTCTCGAGAGTCCTTACAAATCGCTTGGCCTCTAGACTTGACGAGTTCCAACCTCCGGAGCAGGCTGGGTTTCGCAAAGGCTACAGTACGGTAGACCACATCCACACGCTGAGACAGGTTATTCAGAAGACTGAAGAATACAATCGTCCTCTGTGTCTCGCGTTTGTGGACTACGAAAAAGCCTTCGACCCCGTCGAAACTTGGGCTGTTCTGGAATCCTTACAGCGATGTCTAGTCGATTATCGGTACGTTGAGGTGTTGAAGAGTTTATATAAAGCCGCCAAAATGACAGTTCAGATCCAAAACCAGCAGACAAACCCGATTGAGCTTCACAGAGGGGTGCGACAGGGTGACGTTATATCGCCGAAGCTGTTCACTGCTGCTCTCGAGGATGTCTTCAAGACTCTGGACTGGAGTAAGCTGGGCATCAATGTCAATGGCGAGTATCTTTCACACCTCCGATTTGCGTACGATATCGTTATAATGGCAGAGTCGCTAGAGGATCTCAGCTGTATGCTAGGTGAGCTCAATGCCGCGTCACGACGTGTTGGTCTGGGAATGAATCTGGACAAAATTAAGGTCATGTTCAACGACCATATCATTCCTGGACCGGTAATAGTCGAATCTGCGGTACTCGAAGTTGTGTCTGAATACACCTATCTAGGCCAAATTATTCAGCTGGGCAGGGCCAACTTTGAGAAGGAAGCTGATAGGCGCATACAGTTGGGCTGGGCTGCGTATGGAAAACTCCGTCACGTCTTGAACTCAGCAATCCCGCAATGCTTAAAGACAAAAGTTTTCAACGCTTGCGTGCTGCAGATCATGACATTTGGCGCTGAAACGTGGACATTGCCGTAG
Protein
MKQRRETADAAPSDGKTINTKIRKLSRRDLRQFNTTKIKEAIEQNKGTKVFIRQQQLGRSHLTKLKTADGRIVDSRSEVLTEVESYYCSLYASHAPKPFAHPENDHRAPLVRHYTEDIPDVSIEEIRAALEQLRKYNRATGDDGLSTELLKASGTPVLNQLCTTFNTVIQKTTTPEAWSKGTVILFFKKGDRTLLKNYRPISLLSHIYKLFSRVLTNRLASRLDEFQPPEQAGFRKGYSTVDHIHTLRQVIQKTEEYNRPLCLAFVDYEKAFDPVETWAVLESLQRCLVDYRYVEVLKSLYKAAKMTVQIQNQQTNPIELHRGVRQGDVISPKLFTAALEDVFKTLDWSKLGINVNGEYLSHLRFAYDIVIMAESLEDLSCMLGELNAASRRVGLGMNLDKIKVMFNDHIIPGPVIVESAVLEVVSEYTYLGQIIQLGRANFEKEADRRIQLGWAAYGKLRHVLNSAIPQCLKTKVFNACVLQIMTFGAETWTLP

Summary

EMBL
FJ265551    ADI61819.1    FJ265542    ADI61810.1    RSAL01002130    RVE40575.1    + More
FJ265549    ADI61817.1    FJ265544    ADI61812.1    FJ265550    ADI61818.1    FJ265545    ADI61813.1    FJ265543    ADI61811.1    RSAL01002362    RVE40503.1    EF113398    EF113401    ABO45231.1    MRZV01002136    PIK34564.1    AAGJ04050748    KZ149985    PZC75698.1    GFAA01001426    JAU02009.1    MRZV01000249    PIK54411.1    MRZV01000899    PIK42833.1    KZ150108    PZC73382.1    ODYU01004088    SOQ43598.1    KZ150317    PZC71439.1    JARK01001639    EYB85201.1    FJ265562    ADI61830.1    JARK01001389    EYC11015.1    KZ149907    PZC78256.1    FJ265564    ADI61832.1    GBGD01000453    JAC88436.1    JARK01001340    EYC31295.1    FJ265561    ADI61829.1    JARK01001362    EYC18843.1    EYC18844.1    JARK01001677    EYB83167.1    GBBI01004877    JAC13835.1    JARK01001351    EYC23395.1    EYB83168.1    JARK01000173    EYC41342.1    KZ150485    PZC70710.1    JARK01000388    EYC37469.1    JARK01001462    EYB98997.1    JARK01001370    EYC16150.1    JARK01001655    EYB84321.1    GDKW01001596    JAI54999.1    JARK01001434    EYC02684.1    JARK01001349    EYC24735.1    JARK01001346    EYC26784.1    JARK01001344    EYC28218.1    JARK01001341    EYC29807.1    JARK01001438    EYC02012.1    JARK01001517    EYB93530.1    JARK01001361    EYC19034.1    JARK01001473    EYB97806.1    JARK01001378    EYC13977.1    JARK01001406    EYC07496.1    JARK01001568    EYB89432.1    JARK01001343    EYC28635.1    JARK01001500    EYB95040.1    EYC28825.1    JARK01000224    EYC40225.1    EYC02111.1    JARK01001630    EYB85641.1    JARK01001348    EYC25048.1    JARK01000347    EYC38051.1    EYC25050.1    EYC31303.1    JARK01000248    EYC39628.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    JARK01001435    EYC02496.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    EYC25046.1    JARK01001359    EYC20105.1    EYB98081.1    EYC40601.1    EYC25049.1    JARK01001342    EYC29360.1    EYC30828.1    JARK01000460    EYC36749.1    JARK01001365    EYC18010.1    JARK01001621    EYB86109.1    JARK01001531    EYB92324.1    JARK01000802    EYC34990.1    JARK01001421    EYC04912.1    EYC31302.1    JARK01001648    EYB84653.1    JARK01001338    EYC33297.1    JARK01000109    EYC42952.1    JARK01000132    EYC42415.1    JARK01000008    EYC46079.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    EYC28216.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01826   TIL
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR016186   C-type_lectin-like/link_sf       
IPR016187   CTDL_fold       
IPR029052   Metallo-depent_PP-like       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
SSF56436   SSF56436       
Gene 3D
PDB
6AR3     E-value=0.016205,     Score=91

Ontologies

Topology

Length:
495
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.04896
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02236
outside
1  -  495
 
 

Population Genetic Test Statistics

Pi
315.198932
Theta
212.017884
Tajima's D
1.519094
CLR
0.01602
CSRT
0.794160291985401
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号