SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16257
Pre Gene Modal
BGIBMGA013994
Annotation
PREDICTED:_juvenile_hormone_epoxide_hydrolase-like_protein_3_isoform_X1_[Bombyx_mori]
Full name
Glutathione peroxidase       + More
Epoxide hydrolase      
Juvenile hormone epoxide hydrolase      
Juvenile hormone epoxide hydrolase 1      
Alternative Name
CfEH1
Juvenile hormone epoxide hydrolase I
Juvenile hormone-specific epoxide hydrolase I
Location in the cell
Cytoplasmic   Reliability : 1.675 Mitochondrial   Reliability : 1.039
 

Sequence

CDS
ATGAATTCCAACGAAAAAAATAAGTCATTCAAATCATTTATTCTCATCACTGTCATACAAGTGCTCAGCGCATATTATCTGTATCGCTTTTTCTTCGTACCACCTGATATGCCAGCACTTGACACTGAACAATGGTGGGGCCCGTACCCTATGGACTTGGACCACGATAAATCAATAAGACCGCTAACGATAGAATTTTCTGATGTGATGATAAACGATCTACGCGAGCGACTTCTCCACCGAAGACCCCTACAGCCACCCTTAGAAAATGTTGGATTCACATACGGCTTCAACCCAAGATATTTAAACCAAATAATGGAGTATTGGCATAACAAATACAACTTTAAAGAGAGGGAACAGTTTTTGAACCAATACGATCACTTTGTAACCAATATCCAGGGTTTGGACATACATTTCATGCATATAAAACCTAAGAACATTGCTGGTCTTGAGGTGGTTCCTCTAATCATGCTGCATGGATGGCCCGGTTCATTCAGGGAATTCTATGATGTCATCCCATATTTAATGGCAGAACAGCCAGAACAAAAAATCGCTTTTGAAATCATCGTGCCAAGCTTACCCGGTTTTGGTTACTCACAGGCCTCGGTGAGACCAGGTTTGGGTCCAGCTGAAATGGCGGTGATCATCAACAATCTCATGAAGAGGATCGGCCATGATAAATATTACATACAAGGTGGAGACCTAGGGCACACTGTTGGCTCCATCATTGCTACTGCATTCCCTGAAAACGTATTAGGATTTCACACAAATTTCCCAGTGCTTCTATCTCATAGAGCTGCTCTCTTATATATAACTTGTGGCTCTTTGATTCCATCTCTAATTGAAACGAAAGAATTGCAACCCCGCCTGTACCCGCTATCCGAGCACTGGTCTAGACTCATTGAGGAGTCAGGGTACATGCACATTCAAGCCACAAAACCCGAGACTGTCGGTGTGGGACTATCAGACTCGCCAGCAGGCCTAGCAGCCTACATTCTAGAAAAGTTTTCAACTTGGACAAATCCTGATAACAAGAAGGCCGGTGACGGAAACCTCTTGAAGAAGTTCTCTTTGAATCAGCTATTGGATAATCTGATGATATACTGGGCCACTAACACTGTCACAACCAGCATGAGGGTGTATGCTGAATCATTTAATGAAAAACAAAACTTTCTTATTTTCGACAGGATACCAACAAATGTTCCGACGTGGGGTATAAAATTCAAGTATGAACTGATGTACCAACCGGACACAGCATTAAGTTTCAAATACAAGAAGTACTTGCAGAGCACTGTGGTGGAGGACGGTGGTCACTTCGCTGCCATGGAATATCCTGAATTGATGGCCAAAGATATCATACAAGCTGTGATTAAATTTCAAAAATTTTGGAATTTCGAAAAACAAGAATCTAACGAAACGCCGCCTCTCCACGAGACCGCGAGAACAGTATACGAATTTACAGTTAAATCAATAAACGGACGCGACGTCAAGCTGTCAGATTACAAAGGGAACGTGCTGCTCATTGTCAATGTAGCCTCTCAGTGCGGCCTTACGGCCACCAACTATCAACAACTCAACGAGCTACACGAAAAGTACCACCAGAAAGGTCTACGTATACTGGCCTTCCCGTGCAACCAGTTCAACGGCCAAGAACCAGGTACAGCTAAGGACATTCTGAACTTCACAAAAGACAGAGGCGTTAAATTTGATCTGTTTGAAAAAGTCGATGTGAACGGTGACAACGCGCATCCGCTTTGGAAGTTTCTGAAGAAGGCGCAGAGCGGGACGATTGGTGATTTTATCAAGTGGAACTTTAGTAAGTTCGTAGTCGACAGAAACGGCGTGCCCGTCGAGAGATACGCGCCGCATGTCAATCCACTGGATCTGGAAAAGGATTTGGCCAAATATTGGTAA
Protein
MNSNEKNKSFKSFILITVIQVLSAYYLYRFFFVPPDMPALDTEQWWGPYPMDLDHDKSIRPLTIEFSDVMINDLRERLLHRRPLQPPLENVGFTYGFNPRYLNQIMEYWHNKYNFKEREQFLNQYDHFVTNIQGLDIHFMHIKPKNIAGLEVVPLIMLHGWPGSFREFYDVIPYLMAEQPEQKIAFEIIVPSLPGFGYSQASVRPGLGPAEMAVIINNLMKRIGHDKYYIQGGDLGHTVGSIIATAFPENVLGFHTNFPVLLSHRAALLYITCGSLIPSLIETKELQPRLYPLSEHWSRLIEESGYMHIQATKPETVGVGLSDSPAGLAAYILEKFSTWTNPDNKKAGDGNLLKKFSLNQLLDNLMIYWATNTVTTSMRVYAESFNEKQNFLIFDRIPTNVPTWGIKFKYELMYQPDTALSFKYKKYLQSTVVEDGGHFAAMEYPELMAKDIIQAVIKFQKFWNFEKQESNETPPLHETARTVYEFTVKSINGRDVKLSDYKGNVLLIVNVASQCGLTATNYQQLNELHEKYHQKGLRILAFPCNQFNGQEPGTAKDILNFTKDRGVKFDLFEKVDVNGDNAHPLWKFLKKAQSGTIGDFIKWNFSKFVVDRNGVPVERYAPHVNPLDLEKDLAKYW

Summary

Description
Catalyzes juvenile hormone hydrolysis.
Catalyzes juvenile hormone hydrolysis. Degrades juvenile hormone III (JH III) about 3 times and 5 times slower than juvenile hormone I (JH I) and II (JH II), respectively. Degrades cis-stilbene oxide and trans-stilbene oxide about 18 and 43 times slower than JH III, respectively.
Catalytic Activity
1-(4-methoxyphenyl)-N-methyl-N-[(3-methyloxetan-3-yl)methyl]methanamine + H2O = 2-{[(4-methoxybenzyl)(methyl)amino]methyl}-2-methylpropane-1,3-diol
cis-stilbene oxide + H2O = (1R,2R)-hydrobenzoin
Biophysicochemical Properties
0.52 uM for juvenile hormone III
Subunit
Homodimer.
Similarity
Belongs to the glutathione peroxidase family.
Belongs to the peptidase S33 family.
Keywords
3D-structure   Aromatic hydrocarbons catabolism   Complete proteome   Endoplasmic reticulum   Hydrolase   Membrane   Microsome   Reference proteome   Transmembrane   Transmembrane helix   Direct protein sequencing  
Feature
chain  Epoxide hydrolase
EC Number
3.3.2.9
EMBL
BABH01018608    AB293556    BAH97090.1    KQ460417    KPJ14867.1    KZ150476    + More
PZC70740.1    KJ579233    AIN34709.1    NWSH01001212    PCG72103.1    RSAL01000025    RVE52162.1    KQ459588    KPI97739.1    KU755500    ARD71210.1    ODYU01004100    SOQ43618.1    KT261710    ALJ30250.1    BABH01018379    AY377854    AB362775    AAQ87024.1    BAF81491.1    KZ150418    PZC70941.1    AF035482    AAB88192.1    DQ431847    ABD85119.1    U73680    AAB18243.1    KQ459764    KPJ20089.1    AGBW02009550    OWR50536.1    RSAL01000177    RVE45005.1    NWSH01000520    PCG75887.1    GALX01002976    JAB65490.1    KQ971321    EFA00568.1    AB534186    BAI49687.1    AF503908    AAM22694.1    AB534189    BAI49690.1    RSAL01000008    RVE53920.1    JTDY01000179    KOB78426.1    KX855995    ARE68677.1    ODYU01001536    SOQ37891.1    KU941586    AMR44689.1    BT128165    AEE63126.1    GL732643    EFX69015.1    AXCM01002766    RVE45007.1    LJIG01001532    KRT85408.1    ACPB03008739    GAHY01001290    JAA76220.1    KP271046    AKF11871.1    QOIP01000006    RLU21450.1    KQ459547    KPJ00030.1    GL888384    EGI61928.1    GDIP01250763    GDIP01043274    JAM60441.1    GEZM01096421    JAV54922.1    GEZM01096422    JAV54921.1    KA645900    AFP60529.1    GAPW01001360    JAC12238.1    AB293557    BAH97091.1    GDIQ01210360    GDIQ01190372    JAK41365.1    GAPW01001359    JAC12239.1    GGFJ01005082    MBW54223.1    GGFJ01005028    MBW54169.1   
Pfam
PF06441   EHN        + More
PF00255   GSHPx
PF14529   Exo_endo_phos_2
PF00078   RVT_1
Interpro
IPR029759   GPX_AS        + More
IPR029760   GPX_CS       
IPR000889   Glutathione_peroxidase       
IPR029058   AB_hydrolase       
IPR036249   Thioredoxin-like_sf       
IPR010497   Epoxide_hydro_N       
IPR016292   Epoxide_hydrolase       
IPR000639   Epox_hydrolase-like       
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
SUPFAM
SSF52833   SSF52833        + More
SSF53474   SSF53474       
SSF56219   SSF56219       
Gene 3D
PDB
4QLA     E-value=1.64658e-137,     Score=1256

Ontologies

Topology

Subcellular location
Endoplasmic reticulum membrane  
Microsome membrane  
Length:
637
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
20.25292
Exp number, first 60 AAs:
20.1975
Total prob of N-in:
0.99548
POSSIBLE N-term signal
sequence
inside
1  -  12
TMhelix
13  -  32
outside
33  -  637
 
 

Population Genetic Test Statistics

Pi
259.077384
Theta
168.849024
Tajima's D
1.604172
CLR
0.026608
CSRT
0.810559472026399
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号