SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16245
Pre Gene Modal
BGIBMGA012113
Annotation
PREDICTED:_uncharacterized_protein_LOC106720810_[Papilio_machaon]
Full name
ATP-dependent DNA helicase      
Location in the cell
Cytoplasmic   Reliability : 1.197 Mitochondrial   Reliability : 1.142 Nuclear   Reliability : 1.494
 

Sequence

CDS
ATGAGAGTGCAACTACACAATGATGTACAATCTGGACAATATGCTGCTGCTCTTCTTAAAATTGGAGAAGATCGTATGGCAAAGGATGGTAATGGCATGATTACATTGGATCGTGAATTCTGCAATGTTGTGCATAATCCAGATGATCTAAATAACTTCGTCTATAGCGAACTGCTAACTAATATGAGGAATAGAGACTGGTTATGTGAAAGAGCAATTTTAGCGCCGACGAATGAAATGGTGGGACAGATAAACGAGCAAATTATGTCACGCGTGGAAAGTGATATTGTTGAGTTTCTCTCTGTAGACACTGTAATGGATACTGAACAAGTAACATCATACCCTGTAGAATTTCTTAATTCTTTAGAACTGTCGGGAGTACCTTCACACAAACTGAGGCTGAAAGTAGGCGTTCCTGTCCTTTTAATGCGGAATTTAGATGCACCAAGACTGTGTAATGGCACACGGTTGCAAGTGACACACCTCGGTCGCAATATTGTAAAAGCAATCATTATGACTGGAATGGCAAAAGGAGAGAACGTTTTAATCCCCCGTATACCCATAATTCCGACAGATTTGCCATTCCAGTTTAAGAGATTACAGTTTCCGCTGAAAATCGCATTCGCTATGACGATAAATAAAGCTCAGGGGCAAACATTAAAAGTAGCCGGCATTAATTTAGAAAAGAGTTGTTTTTCTCACGGACAATTATACGTGGCTTGCTCACGTGTTTCAAGTCCACAGAATCTCCATGTGTTGGCCAGAGAGGGAAAAACAAAGAACATAGTTTACAAAAATGTACTACAGTAA
Protein
MRVQLHNDVQSGQYAAALLKIGEDRMAKDGNGMITLDREFCNVVHNPDDLNNFVYSELLTNMRNRDWLCERAILAPTNEMVGQINEQIMSRVESDIVEFLSVDTVMDTEQVTSYPVEFLNSLELSGVPSHKLRLKVGVPVLLMRNLDAPRLCNGTRLQVTHLGRNIVKAIIMTGMAKGENVLIPRIPIIPTDLPFQFKRLQFPLKIAFAMTINKAQGQTLKVAGINLEKSCFSHGQLYVACSRVSSPQNLHVLAREGKTKNIVYKNVLQ

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
Feature
chain  ATP-dependent DNA helicase
EC Number
3.6.4.12
EMBL
BABH01016327    BABH01021294    BABH01021295    RSAL01000260    RVE43353.1    KE125416    + More
EPB68564.1    KN773623    KIH45171.1    KN768221    KIH46987.1    GECZ01022632    JAS47137.1    KN726652    KIH67553.1    JOJR01000352    RCN39175.1    KN726977    KIH66756.1    KN739487    KIH54222.1    KN727000    KIH66715.1    ABLF02006664    GAKP01015355    JAC43597.1    KN747262    KIH51216.1    GGMR01007248    MBY19867.1    JOJR01000395    RCN38503.1    KN730120    KIH61447.1    JARK01000714    EYC35207.1    KN743176    KIH52626.1    ABLF02004758    ABLF02010540    KE126587    EPB66060.1    GGMR01003219    MBY15838.1    KN739098    KIH54434.1    KN768033    KIH47189.1    GAIX01013838    JAA78722.1    LC056060    BAW33744.1    ABLF02030014    HQ009558    AEE09607.1    GAKP01009346    JAC49606.1    GECZ01026766    JAS43003.1    KN739955    KIH53984.1    ABLF02027436    ABLF02011512    ABLF02065998    KQ417009    KOF94238.1    GECU01024866    GECU01018275    GECU01015236    JAS82840.1    JAS89431.1    JAS92470.1    ABLF02041349    KQ415755    KOG00729.1    NIVC01001359    PAA68995.1    KQ419659    KOF82676.1    GEDC01024516    GEDC01006142    JAS12782.1    JAS31156.1    NIVC01000111    PAA90396.1    KN730017    KIH61566.1    KQ419625    KOF82809.1    NIVC01001486    PAA67379.1    NIVC01000366    PAA84583.1    NIVC01000229    PAA87485.1    ABLF02016601    ABLF02024213    ABLF02041347    RSAL01000338    RVE42429.1    NIVC01001445    PAA67902.1    UYRW01004572    VDM92857.1    ABLF02042290    RSAL01001639    RVE40746.1    LBMM01007929    KMQ89299.1    BABH01039432    KQ425876    KOF68891.1    JOJR01000539    RCN36628.1    KQ422072    KOF75554.1    KN736527    KIH55917.1    ABLF02024220    ABLF02041348    GEDC01007314    JAS29984.1    NKXS01013118    PIM96964.1    ABLF02039419    ABLF02041372    ABLF02063377    ABLF02041819    NEVH01005285    PNF38967.1    ABLF02033400    ABLF02016932    ABLF02023575    GGFJ01008921    MBW58062.1    ABLF02021501    ABLF02028709    ABLF02028715    ABLF02048760    ABLF02055417    ABLF02055419    ABLF02059664    ABLF02003694    ABLF02021131    ABLF02042289    ABLF02006222    JOJR01002614    RCN28445.1    KN775179    KIH44846.1    APGK01055334    KB741262    KB631831    ENN71556.1    ERL86591.1    ABLF02035713    KE125929    EPB66767.1    KQ417234    KOF93074.1    ABLF02033384    ABLF02026638    JOJR01001936    RCN29467.1    GFWV01012558    MAA37287.1    GBXI01006514    JAD07778.1   
Pfam
PF05970   PIF1        + More
PF10262   Rdx
PF14214   Helitron_like_N
PF02689   Herpes_Helicase
Interpro
IPR010285   DNA_helicase_pif1-like        + More
IPR027417   P-loop_NTPase       
IPR011893   Selenoprotein_Rdx-typ       
IPR036249   Thioredoxin-like_sf       
IPR025476   Helitron_helicase-like       
IPR003840   DNA_helicase       
IPR038765   Papain-like_cys_pep_sf       
IPR003653   Peptidase_C48_C       
SUPFAM
SSF52540   SSF52540        + More
SSF52833   SSF52833       
SSF54001   SSF54001       
PDB
6HPU     E-value=8.58275e-11,     Score=159

Ontologies

Topology

Length:
269
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01848
Exp number, first 60 AAs:
0
Total prob of N-in:
0.09803
outside
1  -  269
 
 

Population Genetic Test Statistics

Pi
48.25524
Theta
50.360654
Tajima's D
0.323686
CLR
0
CSRT
0.455477226138693
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号