SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16225
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.952
 

Sequence

CDS
ATGGAGAAAAGTATGGAAATTCTATTGGCAAAATTAGATGAAAAGTTAGACCAACAAACTAAACTTATAACAACTACAGTAACACAAAATGTCATGGCAGCACTAGACGAAAAGTTTAAAGCGATCACCGAAGAAAACACCCAACTCAAAAATAAAATAAGTGAGCTAGAGTTAAAATTGAAATTCGCTGATAAGGAGAAGCGCAAAAATAACCTTGTCTTTTTTGGCATCGAGGAAGGAAAAGCAACAACAGAAACGGAGCTAGTAGACTATATAAAAGACATTATACTGGAAATGGGAGTACATTTTGAAACCTTCGAAATTAATAATACTTACAGGATCGGTAAAAAAGAGCTCGATAAAAATCGCCCTGTTGTAGTCTCACTCACAACTACATGGAAAAAACACATGATTCTGCGAAATAGACGTAACCTACAAGAAGGTATAAATATCAAAGAGGACTACCCTAAAGAAATAATAGAAAAACGTAAACAACTACAGCGGCAAGTTGAAGAGGAAAAGAACAAAGGGAATATAGCGTTCATCAAATACGACAAACTGATAATAAAGAAAACACATGAAAGCAACAGAGAAAAGAGGAAACGAGAGACTTCAAGATCACCGAAAACACCATCACAAAAGAAAGTCAATGCAAAACACAGTCATTCCATTAATTCTCCCACAACAGAATCACTCAAAGAAATTATTGCTTCCGACGCAGAAACTGGGATTAAATACAGAAGATTACAAAACAAATTGAAAGAGATGCTAGTCAGCAAACCCAGGAGCAAAGAAAGCTATTTAAGCAAGGAGACACTAGAACTATTGGATAAAAGAAGAACACTAATATCAAATAAAGGGGATAAAGAAAGACGCCAAAAAATTGCAAACCTTAGCAAGAAAATTAAGGAGAATATAAGAAAAGACCGTAGAGAGAAAAGAAATAGTGTTTTAGAAGAAAATATAAAAAGAACAGGAGGAACAAAAAAGGCTCTGAAGCAACTAAGCGAACATGGGAAAGAATGGATATTGAAACTGAACCAACGCGAATCTAACTTAATTAACCGACTCTCAATACTGAAACTAGCCACGGACTATTACCGCCTATTGTATTCTGATAAATTAGGTTCAGGGTTGGACACAATTCCGGAAGTTTACGAACCAAATGAAAACAAAGTAGACGAAGTGCCAGACATCCTTGCCTCAGAGGTAACCAAGGCAATAAAATCCCAAAAACTCGAGAAAGCTCCAGGGCCGGACAAGATACCTAACGAAATGCTTAAGGGAACTTTAGAGGAAATCAGTCCTGTGCTGGCAAAACTCTTCAATGAAATCCTACAAACAAGGCAAATCCCAGAAGAATGGACCGAGTGAGCTTAA
Protein
MEKSMEILLAKLDEKLDQQTKLITTTVTQNVMAALDEKFKAITEENTQLKNKISELELKLKFADKEKRKNNLVFFGIEEGKATTETELVDYIKDIILEMGVHFETFEINNTYRIGKKELDKNRPVVVSLTTTWKKHMILRNRRNLQEGINIKEDYPKEIIEKRKQLQRQVEEEKNKGNIAFIKYDKLIIKKTHESNREKRKRETSRSPKTPSQKKVNAKHSHSINSPTTESLKEIIASDAETGIKYRRLQNKLKEMLVSKPRSKESYLSKETLELLDKRRTLISNKGDKERRQKIANLSKKIKENIRKDRREKRNSVLEENIKRTGGTKKALKQLSEHGKEWILKLNQRESNLINRLSILKLATDYYRLLYSDKLGSGLDTIPEVYEPNENKVDEVPDILASEVTKAIKSQKLEKAPGPDKIPNEMLKGTLEEISPVLAKLFNEILQTRQIPEEWTEXA

Summary

Ontologies

Topology

Length:
459
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00139
outside
1  -  459
 
 

Population Genetic Test Statistics

Pi
208.229513
Theta
157.726579
Tajima's D
2.429714
CLR
10.586697
CSRT
0.936903154842258
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号