SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO16220
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.744
 

Sequence

CDS
ATGATGATCGTAGATCGTGCTAACATCAACCAACCGGAAGTCCAACATATAGCGGGATGCGAGGTAGTTAATAGCTATGTATATCTAGGCTCCACTATCACCAACGCTGGAGGCTGCGAAGATGAGATCCGAAGACGTTGTGCCGTGACAAGATCCTCAGTTGAGAGGCTAACAAAGATTTGGAGAGACCGCAGAATAACCAAAAATACAAAAGTTCGGTTAATGAGATGCCTGGTCTTTCCAATCTTTCTGTATGGGGCTGAGACGTGGACGCTGAGGATGCAAGACCGTCGTAAGATCGACGCACTAGAAATGTGGTGTTGGAGACGTCTCCTCAGAATTCCGTGGACCGCGCACCGTACCAACATTTCGATCCTGAAAGAGCTCAACATCAAGGAGAGACTATCGTCAACAGTCCAATTACGAATCCTCAAGTTCTTCGGGCACATCGCTCGTAATGAGGACTCCATTGAGCGGTTGGTGGTGCAAGGGAAAATCGAGGGCAAAAGATCTCGCGGACGATCTCCAACACGATGGACCGACCTCATAAAATCTGTTACTCACTCCAACATAAATGTTTGCTCTCACTCTGCGAAACATCGTGCCACATGGCGTCGCATCGCGAGAGCATCGGTATCGCAGGATCCGACTGATACACCACGACCACTCTGTCAAGAGTGTACGAATAGGAAAAATTGGTAA
Protein
MMIVDRANINQPEVQHIAGCEVVNSYVYLGSTITNAGGCEDEIRRRCAVTRSSVERLTKIWRDRRITKNTKVRLMRCLVFPIFLYGAETWTLRMQDRRKIDALEMWCWRRLLRIPWTAHRTNISILKELNIKERLSSTVQLRILKFFGHIARNEDSIERLVVQGKIEGKRSRGRSPTRWTDLIKSVTHSNINVCSHSAKHRATWRRIARASVSQDPTDTPRPLCQECTNRKNW

Summary

Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
233
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
17.10246
Exp number, first 60 AAs:
0.03548
Total prob of N-in:
0.87800
inside
1  -  71
TMhelix
72  -  91
outside
92  -  233
 
 

Population Genetic Test Statistics

Pi
250.188914
Theta
79.251898
Tajima's D
4.978188
CLR
1.230962
CSRT
0.999950002499875
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号